Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FAM223B Gene

Subcategory (RNA class) for FAM223B Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for FAM223B Gene

  • Family With Sequence Similarity 223 Member B (Non-Protein Coding) 2 3 5
  • Long Intergenic Non-Protein Coding RNA 204B 2 3
  • Non-Protein Coding RNA 204B 2 3
  • LINC00204B 3 4
  • CXorf52B 3 4
  • Family With Sequence Similarity 223, Member B (Non-Protein Coding) 2
  • Chromosome X Open Reading Frame 52B 2
  • NCRNA00204B 3
  • CXorf52 3

External Ids for FAM223B Gene

Previous HGNC Symbols for FAM223B Gene

  • CXorf52B
  • NCRNA00204B
  • LINC00204B

Previous GeneCards Identifiers for FAM223B Gene

  • GC0XM153863

Summaries for FAM223B Gene

GeneCards Summary for FAM223B Gene

FAM223B (Family With Sequence Similarity 223 Member B (Non-Protein Coding)) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for FAM223B Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FAM223B Gene

Genomics for FAM223B Gene

GeneHancer (GH) Regulatory Elements for FAM223B Gene

Promoters and enhancers for FAM223B Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XI154627 Enhancer 0.2 Ensembl 0.4 +5.3 5281 0.2 ATF4P1 FAM223B
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around FAM223B on UCSC Golden Path with GeneCards custom track

Genomic Locations for FAM223B Gene

Genomic Locations for FAM223B Gene
713 bases
Minus strand

Genomic View for FAM223B Gene

Genes around FAM223B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FAM223B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FAM223B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM223B Gene

Proteins for FAM223B Gene

  • Protein details for FAM223B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein FAM223B
    Protein Accession:

    Protein attributes for FAM223B Gene

    122 amino acids
    Molecular mass:
    13778 Da
    Quaternary structure:
    No Data Available

neXtProt entry for FAM223B Gene

Post-translational modifications for FAM223B Gene

No Post-translational modifications

No data available for DME Specific Peptides for FAM223B Gene

Domains & Families for FAM223B Gene

Protein Domains for FAM223B Gene


Graphical View of Domain Structure for InterPro Entry



  • Belongs to the FAM223 family.
  • Belongs to the FAM223 family.
genes like me logo Genes that share domains with FAM223B: view

No data available for Gene Families and Suggested Antigen Peptide Sequences for FAM223B Gene

Function for FAM223B Gene

Animal Model Products

Inhibitory RNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for FAM223B Gene

Localization for FAM223B Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for FAM223B Gene

Pathways & Interactions for FAM223B Gene

SuperPathways for FAM223B Gene

No Data Available

Interacting Proteins for FAM223B Gene

Gene Ontology (GO) - Biological Process for FAM223B Gene


No data available for Pathways by source and SIGNOR curated interactions for FAM223B Gene

Drugs & Compounds for FAM223B Gene

No Compound Related Data Available

Transcripts for FAM223B Gene

mRNA/cDNA for FAM223B Gene

(1) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FAM223B Gene

Family with sequence similarity 223, member B (non-protein coding):
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FAM223B Gene

No ASD Table

Relevant External Links for FAM223B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FAM223B Gene

NURSA nuclear receptor signaling pathways regulating expression of FAM223B Gene:


SOURCE GeneReport for Unigene cluster for FAM223B Gene:

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for FAM223B Gene

Orthologs for FAM223B Gene

Evolution for FAM223B Gene

Gene Tree for FAM223B (if available)
Gene Tree for FAM223B (if available)

No data available for Orthologs for FAM223B Gene

Paralogs for FAM223B Gene

(1) SIMAP similar genes for FAM223B Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with FAM223B: view

No data available for Paralogs for FAM223B Gene

Variants for FAM223B Gene

Sequence variations from dbSNP and Humsavar for FAM223B Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs200473276 -- 154,632,400(-) G/A downstream_transcript_variant
rs201862371 -- 154,632,321(-) AGGAAGGAAGGAAGGAAGGA/AGGAAGGAAGGAAGGA downstream_transcript_variant
rs28752147 -- 154,632,095(-) G/A downstream_transcript_variant
rs373374317 -- 154,632,140(-) AAAAAGGAAGGAGGGAAGGAAGGAAGGGAGGAAGGAACGAAGAAA/AAA downstream_transcript_variant
rs4320713 -- 154,632,851(-) C/T non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for FAM223B Gene

Variant ID Type Subtype PubMed ID
esv24250 CNV gain+loss 19812545
esv33199 CNV gain+loss 17666407
esv3369299 OTHER inversion 20981092
esv33784 CNV gain+loss 17666407
esv3577563 CNV gain 25503493
nsv1152200 CNV duplication 26484159
nsv508816 CNV insertion 20534489
nsv518228 CNV gain 19592680
nsv519042 CNV gain 19592680

Additional Variant Information for FAM223B Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for FAM223B Gene

Disorders for FAM223B Gene

Additional Disease Information for FAM223B

No disorders were found for FAM223B Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for FAM223B Gene

Publications for FAM223B Gene

  1. The DNA sequence of the human X chromosome. (PMID: 15772651) Ross MT … Bentley DR (Nature 2005) 3 4 58
  2. Toward a confocal subcellular atlas of the human proteome. (PMID: 18029348) Barbe L … Andersson-Svahn H (Molecular & cellular proteomics : MCP 2008) 3 58

Products for FAM223B Gene

Sources for FAM223B Gene

Loading form....