Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FAM200B Gene

Aliases for FAM200B Gene

  • Family With Sequence Similarity 200 Member B 2 3 5
  • C4orf53 3 4
  • Family With Sequence Similarity 200, Member B 2
  • Chromosome 4 Open Reading Frame 53 2
  • Putative Protein FAM200B 3
  • Protein FAM200B 3

External Ids for FAM200B Gene

Previous GeneCards Identifiers for FAM200B Gene

  • GC04P015033

Summaries for FAM200B Gene

GeneCards Summary for FAM200B Gene

FAM200B (Family With Sequence Similarity 200 Member B) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include nucleic acid binding. An important paralog of this gene is FAM200A.

Additional gene information for FAM200B Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FAM200B Gene

Genomics for FAM200B Gene

GeneHancer (GH) Regulatory Elements for FAM200B Gene

Promoters and enhancers for FAM200B Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH04J015676 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 660.7 -0.6 -562 8.4 CLOCK DMAP1 YY1 SLC30A9 ZNF213 ZNF143 SP3 NFYC GLIS1 RCOR2 FBXL5 FAM200B ENSG00000273133 BST1 RPL10AP7 GC04P015599
GH04J015651 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 21 -27.6 -27566 5.8 HDGF PKNOX1 ATF1 SIN3A DMAP1 ZNF48 YY1 ZNF766 GLIS2 ZNF143 FBXL5 FAM200B ENSG00000273133 RPL10AP7 PROM1 BST1 GC04P015599
GH04J015478 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 10.5 -201.9 -201886 2.4 ARNT ARID4B SIN3A DMAP1 ZNF2 ZNF48 YY1 GLIS2 ZNF143 SP3 CC2D2A FAM200B FBXL5 C1QTNF7 ENSG00000273133 PIR61569
GH04J015649 Enhancer 1.1 ENCODE dbSUPER 17.6 -31.5 -31474 1 ATF1 FOXA2 ARNT ZNF2 GATA2 ZNF143 RUNX3 REST ZNF592 GMEB1 FAM200B FBXL5 ENSG00000273133 GC04P015599
GH04J015736 Enhancer 0.9 dbSUPER 15.3 +59.2 59188 8.6 FOXA2 MLX DNMT3B ZSCAN9 RAD21 RARA YY1 ZNF614 ZNF766 CREM FAM200B CD38 BST1 RPL10AP7 FBXL5 ENSG00000273133 LOC100288771
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around FAM200B on UCSC Golden Path with GeneCards custom track

Genomic Locations for FAM200B Gene

Genomic Locations for FAM200B Gene
23,904 bases
Plus strand
23,904 bases
Plus strand

Genomic View for FAM200B Gene

Genes around FAM200B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FAM200B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FAM200B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM200B Gene

Proteins for FAM200B Gene

  • Protein details for FAM200B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein FAM200B
    Protein Accession:

    Protein attributes for FAM200B Gene

    657 amino acids
    Molecular mass:
    76034 Da
    Quaternary structure:
    No Data Available

neXtProt entry for FAM200B Gene

Post-translational modifications for FAM200B Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for FAM200B Gene

Domains & Families for FAM200B Gene

Gene Families for FAM200B Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for FAM200B Gene


Suggested Antigen Peptide Sequences for FAM200B Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the FAM200 family.
  • Belongs to the FAM200 family.
genes like me logo Genes that share domains with FAM200B: view

Function for FAM200B Gene

Phenotypes From GWAS Catalog for FAM200B Gene

Gene Ontology (GO) - Molecular Function for FAM200B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding IBA --
GO:0003677 DNA binding IBA --
genes like me logo Genes that share ontologies with FAM200B: view

Phenotypes for FAM200B Gene

genes like me logo Genes that share phenotypes with FAM200B: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for FAM200B

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for FAM200B Gene

Localization for FAM200B Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FAM200B gene
Compartment Confidence
nucleus 4
cytosol 2

Gene Ontology (GO) - Cellular Components for FAM200B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm IBA --
GO:0005737 cytoplasm IBA --
genes like me logo Genes that share ontologies with FAM200B: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for FAM200B Gene

Pathways & Interactions for FAM200B Gene

SuperPathways for FAM200B Gene

No Data Available

Interacting Proteins for FAM200B Gene

Gene Ontology (GO) - Biological Process for FAM200B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006357 regulation of transcription by RNA polymerase II IEA --
genes like me logo Genes that share ontologies with FAM200B: view

No data available for Pathways by source and SIGNOR curated interactions for FAM200B Gene

Drugs & Compounds for FAM200B Gene

No Compound Related Data Available

Transcripts for FAM200B Gene

Unigene Clusters for FAM200B Gene

Family with sequence similarity 200, member B:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for FAM200B

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FAM200B Gene

No ASD Table

Relevant External Links for FAM200B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FAM200B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FAM200B Gene

Protein differential expression in normal tissues from HIPED for FAM200B Gene

This gene is overexpressed in Platelet (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for FAM200B Gene

Protein tissue co-expression partners for FAM200B Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of FAM200B Gene:


SOURCE GeneReport for Unigene cluster for FAM200B Gene:


Evidence on tissue expression from TISSUES for FAM200B Gene

  • Nervous system(3.6)
genes like me logo Genes that share expression patterns with FAM200B: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for FAM200B Gene

Orthologs for FAM200B Gene

This gene was present in the common ancestor of chordates.

Orthologs for FAM200B Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia FAM200B 33
  • 99.64 (n)
(Canis familiaris)
Mammalia FAM200B 33
  • 92.54 (n)
(Bos Taurus)
Mammalia FAM200B 33
  • 86.78 (n)
(Mus musculus)
Mammalia 2410018M08Rik 34
  • 28 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 28 (a)
(Danio rerio)
Actinopterygii BX927234.1 34
  • 28 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 24 (a)
Species where no ortholog for FAM200B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FAM200B Gene

Gene Tree for FAM200B (if available)
Gene Tree for FAM200B (if available)
Evolutionary constrained regions (ECRs) for FAM200B: view image

Paralogs for FAM200B Gene

Paralogs for FAM200B Gene

(3) SIMAP similar genes for FAM200B Gene using alignment to 2 proteins:

  • F200B_HUMAN
genes like me logo Genes that share paralogs with FAM200B: view

Variants for FAM200B Gene

Sequence variations from dbSNP and Humsavar for FAM200B Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs1000628361 -- 15,687,731(+) GATTTTTTGGAGGATTTTTTG/GATTTTTTG coding_sequence_variant, inframe_deletion
rs1000834149 -- 15,681,548(+) G/T upstream_transcript_variant
rs1001006260 -- 15,687,310(+) T/C coding_sequence_variant, synonymous_variant
rs1001373279 -- 15,681,670(+) G/C upstream_transcript_variant
rs1001405555 -- 15,689,440(+) G/C 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for FAM200B Gene

Variant ID Type Subtype PubMed ID
dgv315n21 CNV loss 19592680
esv2759227 CNV gain+loss 17122850
nsv428439 CNV gain+loss 18775914
nsv949802 CNV duplication 24416366

Variation tolerance for FAM200B Gene

Gene Damage Index Score: 10.10; 90.22% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for FAM200B Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FAM200B Gene

Disorders for FAM200B Gene

Additional Disease Information for FAM200B

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for FAM200B Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for FAM200B Gene

Publications for FAM200B Gene

  1. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier LW … Wilson RK (Nature 2005) 3 4 58
  2. Genetic associations of variants in genes encoding HIV-dependency factors required for HIV-1 infection. (PMID: 21083371) Chinn LW … O'Brien SJ (The Journal of infectious diseases 2010) 44 58
  3. Identification of host proteins required for HIV infection through a functional genomic screen. (PMID: 18187620) Brass AL … Elledge SJ (Science (New York, N.Y.) 2008) 3 58
  4. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 58
  5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58

Products for FAM200B Gene

Sources for FAM200B Gene

Loading form....