Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FAM167B Gene

Aliases for FAM167B Gene

  • Family With Sequence Similarity 167 Member B 2 3 5
  • Disordered Autoimmunity 2 2 3
  • Protein FAM167B 3 4
  • C1orf90 3 4
  • Family With Sequence Similarity 167, Member B 2
  • Chromosome 1 Open Reading Frame 90 2
  • DIORA-2 3

External Ids for FAM167B Gene

Previous HGNC Symbols for FAM167B Gene

  • C1orf90

Previous GeneCards Identifiers for FAM167B Gene

  • GC01P032487
  • GC01P032712
  • GC01P030829

Summaries for FAM167B Gene

GeneCards Summary for FAM167B Gene

FAM167B (Family With Sequence Similarity 167 Member B) is a Protein Coding gene. An important paralog of this gene is FAM167A.

Additional gene information for FAM167B Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FAM167B Gene

Genomics for FAM167B Gene

GeneHancer (GH) Regulatory Elements for FAM167B Gene

Promoters and enhancers for FAM167B Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01J032246 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 600.4 +5.3 5294 11.9 ZNF652 SP1 CC2D1A CTCF ELF3 MNT CBFA2T2 ZNF148 NKRF MLLT1 LCK FAM167B MTMR9LP LRRC37A12P CCDC28B BSDC1 PTP4A2 GC01M032258
GH01J032178 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 10.6 -66.8 -66779 4.3 HDGF SP1 ZFX ELF3 MNT ZNF148 NKRF POLR2A CEBPG GTF2F1 TXLNA ENSG00000224066 IQCC DCDC2B KPNA6 RBBP4 TMEM234 EIF3I HDAC1 S100PBP
GH01J032106 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 10 -138.8 -138780 3.5 HDGF MTA3 ZNF652 SP1 CC2D1A CTCF ZFX NKRF MLLT1 ZNF121 KPNA6 TMEM39B SNRNP40 TXLNA TSSK3 KHDRBS1 RBBP4 ENSG00000229447 AK2 ENSG00000203325
GH01J032316 Enhancer 0.7 ENCODE 11.6 +69.8 69830 1.8 CTCF RAD21 IKZF1 ZNF143 REST PKNOX1 TRIM22 IKZF2 DPF2 CTBP1 HDAC1 FAM167B LCK ENSG00000224066 IQCC TMEM234 EIF3I DCDC2B ENSG00000233775 MARCKSL1
GH01J032372 Enhancer 0.7 Ensembl ENCODE 10.1 +125.0 124984 1.2 RAD21 IKZF1 RUNX3 CTCF EBF1 SMAD5 POLR2A MARCKSL1 HDAC1 ENSG00000224066 IQCC TMEM234 EIF3I DCDC2B CCDC28B ENSG00000252450 LCK
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around FAM167B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the FAM167B gene promoter:
  • AP-1
  • ATF-2
  • c-Jun
  • NF-kappaB1
  • Sp1
  • STAT1
  • STAT1alpha
  • STAT1beta
  • STAT3

Genomic Locations for FAM167B Gene

Genomic Locations for FAM167B Gene
chr1:32,247,217-32,248,860
(GRCh38/hg38)
Size:
1,644 bases
Orientation:
Plus strand
chr1:32,712,818-32,714,461
(GRCh37/hg19)
Size:
1,644 bases
Orientation:
Plus strand

Genomic View for FAM167B Gene

Genes around FAM167B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FAM167B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FAM167B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM167B Gene

Proteins for FAM167B Gene

  • Protein details for FAM167B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BTA0-F167B_HUMAN
    Recommended name:
    Protein FAM167B
    Protein Accession:
    Q9BTA0
    Secondary Accessions:
    • Q5TDH6

    Protein attributes for FAM167B Gene

    Size:
    163 amino acids
    Molecular mass:
    18414 Da
    Quaternary structure:
    No Data Available

neXtProt entry for FAM167B Gene

Post-translational modifications for FAM167B Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for FAM167B Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for FAM167B Gene

Domains & Families for FAM167B Gene

Gene Families for FAM167B Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for FAM167B Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for FAM167B Gene

GenScript: Design optimal peptide antigens:
  • Protein FAM167B (F167B_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q9BTA0

UniProtKB/Swiss-Prot:

F167B_HUMAN :
  • Belongs to the FAM167 (SEC) family.
Family:
  • Belongs to the FAM167 (SEC) family.
genes like me logo Genes that share domains with FAM167B: view

Function for FAM167B Gene

genes like me logo Genes that share phenotypes with FAM167B: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for FAM167B

Clone Products

  • Applied Biological Materials (abm): Clones for FAM167B - Now 50% OFF >
  • * FAM167B as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * FAM167B tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for FAM167B Gene

Localization for FAM167B Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FAM167B gene
Compartment Confidence
extracellular 2
nucleus 1
endosome 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Actin filaments (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for FAM167B Gene

Pathways & Interactions for FAM167B Gene

PathCards logo

SuperPathways for FAM167B Gene

No Data Available

Interacting Proteins for FAM167B Gene

STRING Interaction Network Preview (showing top 2 STRING interactants - click image to see details)
https://version11.string-db.org/api/image/network?species=9606&limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000362684%0d9606.ENSP00000336790%0d9606.ENSP00000396954%0d
Selected Interacting proteins: ENSP00000362684 for FAM167B Gene via STRING

Gene Ontology (GO) - Biological Process for FAM167B Gene

None

No data available for Pathways by source and SIGNOR curated interactions for FAM167B Gene

Drugs & Compounds for FAM167B Gene

No Compound Related Data Available

Transcripts for FAM167B Gene

mRNA/cDNA for FAM167B Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(7) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Unigene Clusters for FAM167B Gene

Family with sequence similarity 167, member B:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for FAM167B

Clone Products

  • Applied Biological Materials (abm): Clones for FAM167B - Now 50% OFF >
  • * FAM167B as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * FAM167B tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for FAM167B Gene

No ASD Table

Relevant External Links for FAM167B Gene

GeneLoc Exon Structure for
FAM167B
ECgene alternative splicing isoforms for
FAM167B

Expression for FAM167B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FAM167B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FAM167B Gene

This gene is overexpressed in Kidney - Cortex (x4.7).

NURSA nuclear receptor signaling pathways regulating expression of FAM167B Gene:

FAM167B

SOURCE GeneReport for Unigene cluster for FAM167B Gene:

Hs.18449
genes like me logo Genes that share expression patterns with FAM167B: view

No data available for Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for FAM167B Gene

Orthologs for FAM167B Gene

This gene was present in the common ancestor of chordates.

Orthologs for FAM167B Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FAM167B 35 34
  • 99.8 (n)
OneToOne
dog
(Canis familiaris)
Mammalia FAM167B 35 34
  • 90.39 (n)
OneToOne
cow
(Bos Taurus)
Mammalia FAM167B 35 34
  • 90.12 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Fam167b 34
  • 87.04 (n)
mouse
(Mus musculus)
Mammalia Fam167b 17 35 34
  • 84.16 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia FAM167B 35
  • 56 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia FAM167B 35
  • 53 (a)
OneToOne
chicken
(Gallus gallus)
Aves FAM167B 35 34
  • 66.05 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia FAM167B 35
  • 51 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100497502 34
  • 55.62 (n)
zebrafish
(Danio rerio)
Actinopterygii FAM167B 35
  • 45 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10625 35
  • 31 (a)
ManyToMany
-- 35
  • 17 (a)
ManyToMany
Species where no ortholog for FAM167B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FAM167B Gene

ENSEMBL:
Gene Tree for FAM167B (if available)
TreeFam:
Gene Tree for FAM167B (if available)
Aminode:
Evolutionary constrained regions (ECRs) for FAM167B: view image

Paralogs for FAM167B Gene

Paralogs for FAM167B Gene

(1) SIMAP similar genes for FAM167B Gene using alignment to 1 proteins:

  • F167B_HUMAN
genes like me logo Genes that share paralogs with FAM167B: view

Variants for FAM167B Gene

Sequence variations from dbSNP and Humsavar for FAM167B Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1000352411 -- 32,245,944(+) TTATTTACTTATTTACTTATTT/TTATTTACTTATTT upstream_transcript_variant
rs1000383488 -- 32,246,330(+) C/T upstream_transcript_variant
rs1001098526 -- 32,246,701(+) A/G upstream_transcript_variant
rs1001352826 -- 32,247,270(+) C/T 5_prime_UTR_variant
rs1001462083 -- 32,248,305(+) A/G intron_variant

Variation tolerance for FAM167B Gene

Residual Variation Intolerance Score: 75.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.63; 31.30% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for FAM167B Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
FAM167B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for FAM167B Gene

Disorders for FAM167B Gene

Additional Disease Information for FAM167B

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for FAM167B Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for FAM167B Gene

Publications for FAM167B Gene

  1. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 45 58
  2. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory SG … Prigmore E (Nature 2006) 3 4 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 58
  5. Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip. (PMID: 19913121) Talmud PJ … BRIGHT Consortium (American journal of human genetics 2009) 3 58

Products for FAM167B Gene

Sources for FAM167B Gene

Content
Loading form....