Aliases for FAM161B Gene

Aliases for FAM161B Gene

  • FAM161 Centrosomal Protein B 2 3 5
  • Family With Sequence Similarity 161 Member B 2 3
  • FAM161B, Centrosomal Protein 2 3
  • Protein FAM161B 3 4
  • C14orf44 3 4
  • Family With Sequence Similarity 161, Member B 2
  • Chromosome 14 Open Reading Frame 44 2
  • C14_5547 3

External Ids for FAM161B Gene

Previous HGNC Symbols for FAM161B Gene

  • C14orf44

Previous GeneCards Identifiers for FAM161B Gene

  • GC14M073471
  • GC14M074400
  • GC14M054567

Summaries for FAM161B Gene

GeneCards Summary for FAM161B Gene

FAM161B (FAM161 Centrosomal Protein B) is a Protein Coding gene. Diseases associated with FAM161B include Retinitis Pigmentosa. An important paralog of this gene is FAM161A.

Additional gene information for FAM161B Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for FAM161B Gene

Genomics for FAM161B Gene

GeneHancer (GH) Regulatory Elements for FAM161B Gene

Promoters and enhancers for FAM161B Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around FAM161B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the FAM161B gene promoter:
  • AML1a
  • CBF(2)
  • CP1A
  • E47
  • Evi-1
  • GATA-1
  • IRF-1
  • Pax-5
  • TBP

Genomic Locations for FAM161B Gene

Genomic Locations for FAM161B Gene
chr14:73,931,501-73,950,414
(GRCh38/hg38)
Size:
18,914 bases
Orientation:
Minus strand
chr14:74,398,204-74,417,117
(GRCh37/hg19)
Size:
18,914 bases
Orientation:
Minus strand

Genomic View for FAM161B Gene

Genes around FAM161B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FAM161B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FAM161B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM161B Gene

Proteins for FAM161B Gene

  • Protein details for FAM161B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96MY7-F161B_HUMAN
    Recommended name:
    Protein FAM161B
    Protein Accession:
    Q96MY7
    Secondary Accessions:
    • B7Z882
    • J3KNA2

    Protein attributes for FAM161B Gene

    Size:
    647 amino acids
    Molecular mass:
    73647 Da
    Quaternary structure:
    • Interacts with FAM161A.

    Alternative splice isoforms for FAM161B Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for FAM161B Gene

Post-translational modifications for FAM161B Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for FAM161B Gene

No data available for DME Specific Peptides for FAM161B Gene

Domains & Families for FAM161B Gene

Gene Families for FAM161B Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for FAM161B Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for FAM161B Gene

GenScript: Design optimal peptide antigens:
  • Protein FAM161B (F161B_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96MY7

UniProtKB/Swiss-Prot:

F161B_HUMAN :
  • Belongs to the FAM161 family.
Family:
  • Belongs to the FAM161 family.
genes like me logo Genes that share domains with FAM161B: view

Function for FAM161B Gene

Phenotypes From GWAS Catalog for FAM161B Gene

Gene Ontology (GO) - Molecular Function for FAM161B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 22791751
genes like me logo Genes that share ontologies with FAM161B: view
genes like me logo Genes that share phenotypes with FAM161B: view

Animal Model Products

CRISPR Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for FAM161B Gene

Localization for FAM161B Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FAM161B gene
Compartment Confidence
cytoskeleton 5
nucleus 3
cytosol 3

Gene Ontology (GO) - Cellular Components for FAM161B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005881 cytoplasmic microtubule IDA 22791751
GO:0015630 microtubule cytoskeleton IDA 22791751
genes like me logo Genes that share ontologies with FAM161B: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for FAM161B Gene

Pathways & Interactions for FAM161B Gene

PathCards logo

SuperPathways for FAM161B Gene

No Data Available

Interacting Proteins for FAM161B Gene

Gene Ontology (GO) - Biological Process for FAM161B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008150 biological_process ND --
GO:0044782 cilium organization IBA 21873635
genes like me logo Genes that share ontologies with FAM161B: view

No data available for Pathways by source and SIGNOR curated interactions for FAM161B Gene

Drugs & Compounds for FAM161B Gene

No Compound Related Data Available

Transcripts for FAM161B Gene

mRNA/cDNA for FAM161B Gene

(1) REFSEQ mRNAs :
(7) Additional mRNA sequences :
(53) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FAM161B Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b · 3c ^ 4 ^ 5a · 5b ^ 6 ^ 7
SP1:
SP2: -
SP3:
SP4:

Relevant External Links for FAM161B Gene

GeneLoc Exon Structure for
FAM161B
ECgene alternative splicing isoforms for
FAM161B

Expression for FAM161B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FAM161B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for FAM161B Gene

This gene is overexpressed in Monocytes (33.2), Peripheral blood mononuclear cells (18.5), and Ovary (6.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for FAM161B Gene



NURSA nuclear receptor signaling pathways regulating expression of FAM161B Gene:

FAM161B

SOURCE GeneReport for Unigene cluster for FAM161B Gene:

Hs.550547

mRNA Expression by UniProt/SwissProt for FAM161B Gene:

Q96MY7-F161B_HUMAN
Tissue specificity: Ubiquitously expressed.

Evidence on tissue expression from TISSUES for FAM161B Gene

  • Nervous system(4.7)
genes like me logo Genes that share expression patterns with FAM161B: view

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for FAM161B Gene

Orthologs for FAM161B Gene

This gene was present in the common ancestor of chordates.

Orthologs for FAM161B Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FAM161B 33 32
  • 99.15 (n)
OneToOne
dog
(Canis familiaris)
Mammalia FAM161B 33 32
  • 85.57 (n)
OneToOne
cow
(Bos Taurus)
Mammalia FAM161B 33 32
  • 83.98 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Fam161b 17 33 32
  • 81.77 (n)
oppossum
(Monodelphis domestica)
Mammalia FAM161B 33
  • 56 (a)
OneToOne
chicken
(Gallus gallus)
Aves FAM161B 33 32
  • 61.49 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia FAM161B 33
  • 47 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia fam161b 32
  • 49.85 (n)
zebrafish
(Danio rerio)
Actinopterygii fam161b 33
  • 33 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 29 (a)
OneToMany
Species where no ortholog for FAM161B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FAM161B Gene

ENSEMBL:
Gene Tree for FAM161B (if available)
TreeFam:
Gene Tree for FAM161B (if available)
Aminode:
Evolutionary constrained regions (ECRs) for FAM161B: view image

Paralogs for FAM161B Gene

Paralogs for FAM161B Gene

genes like me logo Genes that share paralogs with FAM161B: view

Variants for FAM161B Gene

Sequence variations from dbSNP and Humsavar for FAM161B Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs547039179 likely-benign, not specified 73,950,053(-) AGTGACAGCGATAGTG/AGTGACAGCGATAGTGACAGCGATAGTG 5_prime_UTR_variant, coding_sequence_variant, inframe_insertion
rs1566679742 uncertain-significance, not provided 73,950,472(-) GCGC/GCGCGC upstream_transcript_variant
rs863223938 uncertain-significance, not provided 73,950,447(-) G/A upstream_transcript_variant
rs111833521 benign, not specified 73,950,129(-) G/T coding_sequence_variant, genic_upstream_transcript_variant, missense_variant, upstream_transcript_variant
rs17094161 benign, not specified 73,950,133(-) G/A coding_sequence_variant, genic_upstream_transcript_variant, missense_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for FAM161B Gene

Variant ID Type Subtype PubMed ID
dgv1936n100 CNV gain 25217958
dgv1937n100 CNV gain 25217958
dgv663e212 CNV loss 25503493
esv274934 CNV gain+loss 21479260
nsv1053281 CNV gain 25217958

Variation tolerance for FAM161B Gene

Residual Variation Intolerance Score: 82.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 11.62; 93.11% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for FAM161B Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
FAM161B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FAM161B Gene

Disorders for FAM161B Gene

MalaCards: The human disease database

(1) MalaCards diseases for FAM161B Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
retinitis pigmentosa
  • retinitis pigmentosa 1
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for FAM161B

genes like me logo Genes that share disorders with FAM161B: view

No data available for UniProtKB/Swiss-Prot and Genatlas for FAM161B Gene

Publications for FAM161B Gene

  1. The retinitis pigmentosa 28 protein FAM161A is a novel ciliary protein involved in intermolecular protein interaction and microtubule association. (PMID: 22791751) Zach F … Stöhr H (Human molecular genetics 2012) 3 4 56
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 56
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 56
  5. Proteome-scale Binary Interactomics in Human Cells. (PMID: 27803151) Lievens S … Tavernier J (Molecular & cellular proteomics : MCP 2016) 3 56

Products for FAM161B Gene

Sources for FAM161B Gene