The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-sp... See more...

Aliases for FADS2 Gene

Aliases for FADS2 Gene

  • Fatty Acid Desaturase 2 2 3 4 5
  • Acyl-CoA 6-Desaturase 3 4
  • Delta-6-Desaturase 2 3
  • D6D 3 4
  • Linoleoyl-CoA Desaturase (Delta-6-Desaturase)-Like 2 3
  • Delta(6) Fatty Acid Desaturase 4
  • Delta-6 Fatty Acid Desaturase 3
  • Delta(6) Desaturase 4
  • Delta-6 Desaturase 4
  • EC 1.14.19.3 4
  • EC 1.14.19 54
  • SLL0262 3
  • FADSD6 3
  • LLCDL2 3
  • DES6 3
  • TU13 3

External Ids for FADS2 Gene

Previous HGNC Symbols for FADS2 Gene

  • LLCDL2

Previous GeneCards Identifiers for FADS2 Gene

  • GC11P064097
  • GC11P063159
  • GC11P061834
  • GC11P061359
  • GC11P061340
  • GC11P061352
  • GC11P061583
  • GC11P057923

Summaries for FADS2 Gene

Entrez Gene Summary for FADS2 Gene

  • The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

GeneCards Summary for FADS2 Gene

FADS2 (Fatty Acid Desaturase 2) is a Protein Coding gene. Diseases associated with FADS2 include Fanconi Anemia, Complementation Group D2 and Best Vitelliform Macular Dystrophy. Among its related pathways are alpha-linolenic acid (ALA) metabolism and fatty acid beta-oxidation (peroxisome). Gene Ontology (GO) annotations related to this gene include iron ion binding and oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water. An important paralog of this gene is FADS3.

UniProtKB/Swiss-Prot Summary for FADS2 Gene

  • Acts as a fatty acyl-coenzyme A (CoA) desaturase that introduces a cis double bond at carbon 6 of the fatty acyl chain. Involved in biosynthesis of highly unsaturated fatty acids (HUFA) from the essential polyunsaturated fatty acids (PUFA) linoleic acid (LA) (18:2n-6) and alpha-linolenic acid (ALA) (18:3n-3) precursors. Catalyzes the first and rate limiting step in this pathway which is the desaturation of LA (18:2n-6) and ALA (18:3n-3) into gamma-linoleate (GLA) (18:3n-6) and stearidonate (18:4n-3), respectively (PubMed:12713571). Subsequently, in the biosynthetic pathway of HUFA n-3 series, desaturates tetracosapentaenoate (24:5n-3) to tetracosahexaenoate (24:6n-3), which is then converted to docosahexaenoate (DHA)(22:6n-3), an important lipid for nervous system function (By similarity). Desaturates palmitate to produce the mono-unsaturated fatty acid sapienate, the most abundant fatty acid in sebum (PubMed:12713571). Also desaturates (11E)-octadecenoate (trans-vaccenoate)(18:1n-9), a metabolite in the biohydrogenation pathway of LA (18:2n-6) (By similarity).

Gene Wiki entry for FADS2 Gene

Additional gene information for FADS2 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for FADS2 Gene

Genomics for FADS2 Gene

GeneHancer (GH) Regulatory Elements for FADS2 Gene

Promoters and enhancers for FADS2 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around FADS2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the FADS2 gene promoter:
  • ATF
  • CBF(2)
  • CBF-A
  • CBF-B
  • CBF-C
  • CP1A
  • CP1C
  • E47
  • HEN1
  • Ik-2

Genomic Locations for FADS2 Gene

Genomic Locations for FADS2 Gene
chr11:61,792,980-61,867,354
(GRCh38/hg38)
Size:
74,375 bases
Orientation:
Plus strand
chr11:61,560,452-61,634,826
(GRCh37/hg19)
Size:
74,375 bases
Orientation:
Plus strand

Genomic View for FADS2 Gene

Genes around FADS2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FADS2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FADS2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FADS2 Gene

Proteins for FADS2 Gene

  • Protein details for FADS2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O95864-FADS2_HUMAN
    Recommended name:
    Acyl-CoA 6-desaturase
    Protein Accession:
    O95864
    Secondary Accessions:
    • A8K2M6
    • B7Z634
    • Q6MZQ7
    • Q96H07
    • Q96SV8
    • Q9H3G3
    • Q9Y3X4

    Protein attributes for FADS2 Gene

    Size:
    444 amino acids
    Molecular mass:
    52259 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for FADS2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for FADS2 Gene

Selected DME Specific Peptides for FADS2 Gene

O95864:
  • KVYNITKW
  • WWNHRHFQHHAKPNIF
  • YFFLIGPPLL
  • GHYAGEDAT
  • LWLDAYL
  • FVIGHLKG
  • LLIGELAPE
  • YLPYNHQH
  • SLCAKHGIEYQEKPLLRAL
  • LHVFVLGEWQP
  • LKPLLIGEL
  • EDFRALR
  • KDPDVNM
  • APLVKSLCAKHG
  • QAGWLQHD
  • FLNFIRFLESHWFVWVTQMNH
  • WFSGHLNFQIEHHLFP
  • EDATDAF

Post-translational modifications for FADS2 Gene

  • Ubiquitination at Lys28, Lys42, Lys48, Lys84, Lys87, Lys108, Lys206, Lys398, Lys404, Lys409, Lys417, and Lys435
  • Modification sites at PhosphoSitePlus

Domains & Families for FADS2 Gene

Gene Families for FADS2 Gene

HGNC:
Human Protein Atlas (HPA):
  • Enzymes
  • FDA approved drug targets
  • Predicted intracellular proteins
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for FADS2 Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ56373, highly similar to Homo sapiens fatty acid desaturase 2 (FADS2), mRNA (B7Z634_HUMAN)
  • Delta(6) fatty acid desaturase (FADS2_HUMAN)

Graphical View of Domain Structure for InterPro Entry

O95864

UniProtKB/Swiss-Prot:

FADS2_HUMAN :
  • The histidine box domains may contain the active site and/or be involved in metal ion binding.
  • Belongs to the fatty acid desaturase type 1 family.
Domain:
  • The histidine box domains may contain the active site and/or be involved in metal ion binding.
Family:
  • Belongs to the fatty acid desaturase type 1 family.
genes like me logo Genes that share domains with FADS2: view

Function for FADS2 Gene

Molecular function for FADS2 Gene

UniProtKB/Swiss-Prot Function:
Acts as a fatty acyl-coenzyme A (CoA) desaturase that introduces a cis double bond at carbon 6 of the fatty acyl chain. Involved in biosynthesis of highly unsaturated fatty acids (HUFA) from the essential polyunsaturated fatty acids (PUFA) linoleic acid (LA) (18:2n-6) and alpha-linolenic acid (ALA) (18:3n-3) precursors. Catalyzes the first and rate limiting step in this pathway which is the desaturation of LA (18:2n-6) and ALA (18:3n-3) into gamma-linoleate (GLA) (18:3n-6) and stearidonate (18:4n-3), respectively (PubMed:12713571). Subsequently, in the biosynthetic pathway of HUFA n-3 series, desaturates tetracosapentaenoate (24:5n-3) to tetracosahexaenoate (24:6n-3), which is then converted to docosahexaenoate (DHA)(22:6n-3), an important lipid for nervous system function (By similarity). Desaturates palmitate to produce the mono-unsaturated fatty acid sapienate, the most abundant fatty acid in sebum (PubMed:12713571). Also desaturates (11E)-octadecenoate (trans-vaccenoate)(18:1n-9), a metabolite in the biohydrogenation pathway of LA (18:2n-6) (By similarity).
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(9Z,12Z)-octadecadienoyl-CoA + 2 [Fe(II)-cytochrome b5] + 2 H(+) + O2 = (6Z,9Z,12Z)-octadecatrienoyl-CoA + 2 [Fe(III)-cytochrome b5] + 2 H2O; Xref=Rhea:RHEA:47140, Rhea:RHEA-COMP:10438, Rhea:RHEA-COMP:10439, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:29033, ChEBI:CHEBI:29034, ChEBI:CHEBI:57363, ChEBI:CHEBI:57383; EC=1.14.19.3; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(9Z,12Z,15Z)-octadecatrienoyl-CoA + 2 [Fe(II)-cytochrome b5] + 2 H(+) + O2 = (6Z,9Z,12Z,15Z)-octadecatetraenoyl-CoA + 2 [Fe(III)-cytochrome b5] + 2 H2O; Xref=Rhea:RHEA:47144, Rhea:RHEA-COMP:10438, Rhea:RHEA-COMP:10439, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:29033, ChEBI:CHEBI:29034, ChEBI:CHEBI:71489, ChEBI:CHEBI:74034; EC=1.14.19.3; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=2 [Fe(II)-cytochrome b5] + 2 H(+) + hexadecanoyl-CoA + O2 = (6Z)-hexadecenoyl-CoA + 2 [Fe(III)-cytochrome b5] + 2 H2O; Xref=Rhea:RHEA:37023, Rhea:RHEA-COMP:10438, Rhea:RHEA-COMP:10439, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:29033, ChEBI:CHEBI:29034, ChEBI:CHEBI:57379, ChEBI:CHEBI:74339; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(11E)-octadecenoyl-CoA + 2 [Fe(II)-cytochrome b5] + 2 H(+) + O2 = (6Z,11E)-octadecadienoyl-CoA + 2 [Fe(III)-cytochrome b5] + 2 H2O; Xref=Rhea:RHEA:46064, Rhea:RHEA-COMP:10438, Rhea:RHEA-COMP:10439, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:29033, ChEBI:CHEBI:29034, ChEBI:CHEBI:74296, ChEBI:CHEBI:85652; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(9Z,12Z,15Z,18Z,21Z)-tetracosapentaenoyl-CoA + 2 [Fe(II)-cytochrome b5] + 2 H(+) + O2 = (6Z,9Z,12Z,15Z,18Z,21Z)-tetracosahexaenoyl-CoA + 2 [Fe(III)-cytochrome b5] + 2 H2O; Xref=Rhea:RHEA:36999, Rhea:RHEA-COMP:10438, Rhea:RHEA-COMP:10439, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:29033, ChEBI:CHEBI:29034, ChEBI:CHEBI:74083, ChEBI:CHEBI:74086; Evidence=. ;.
UniProtKB/Swiss-Prot Induction:
Repressed by dietary highly unsaturated fatty acids.

Enzyme Numbers (IUBMB) for FADS2 Gene

Phenotypes From GWAS Catalog for FADS2 Gene

Gene Ontology (GO) - Molecular Function for FADS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004768 stearoyl-CoA 9-desaturase activity IEA --
GO:0016213 linoleoyl-CoA desaturase activity TAS --
GO:0016491 oxidoreductase activity IEA --
genes like me logo Genes that share ontologies with FADS2: view
genes like me logo Genes that share phenotypes with FADS2: view

Animal Models for FADS2 Gene

MGI Knock Outs for FADS2:

Animal Model Products

CRISPR Products

Clone Products

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for FADS2 Gene

Localization for FADS2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for FADS2 Gene

Endoplasmic reticulum membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FADS2 gene
Compartment Confidence
plasma membrane 5
endoplasmic reticulum 4
peroxisome 3
extracellular 1
mitochondrion 1
nucleus 1
cytosol 1

Gene Ontology (GO) - Cellular Components for FADS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane TAS --
GO:0005887 integral component of plasma membrane TAS 9867867
GO:0016020 membrane IEA,HDA 19946888
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with FADS2: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for FADS2 Gene

Pathways & Interactions for FADS2 Gene

genes like me logo Genes that share pathways with FADS2: view

UniProtKB/Swiss-Prot O95864-FADS2_HUMAN

  • Pathway: Lipid metabolism; polyunsaturated fatty acid biosynthesis.

Gene Ontology (GO) - Biological Process for FADS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process IEA --
GO:0006631 fatty acid metabolic process IEA --
GO:0006633 fatty acid biosynthetic process IEA --
GO:0006636 unsaturated fatty acid biosynthetic process TAS,IEA --
GO:0036109 alpha-linolenic acid metabolic process TAS --
genes like me logo Genes that share ontologies with FADS2: view

No data available for SIGNOR curated interactions for FADS2 Gene

Drugs & Compounds for FADS2 Gene

(6) Drugs for FADS2 Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
alpha-linolenic acid Approved, Investigational Nutra Full agonist, Agonist, Target, ligand 0
Evening primrose oil Investigational Nutra Enzyme 24
Omega-6 fatty acids Nutra Enzyme, substrate 0
heme Pharma Agonist 0

(3) Additional Compounds for FADS2 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Stearidonic acid
  • (6Z,9Z,12Z,15Z)-Octadecatetraenoic acid
  • 6,9,12,15-Octadecatetraenoic acid
  • SDA
  • (6Z,9Z,12Z,15Z)-Octadecatetraenoate
  • Stearidonate
20290-75-9
genes like me logo Genes that share compounds with FADS2: view

Transcripts for FADS2 Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FADS2 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8
SP1: - -
SP2:

Relevant External Links for FADS2 Gene

GeneLoc Exon Structure for
FADS2
ECgene alternative splicing isoforms for
FADS2

Expression for FADS2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FADS2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FADS2 Gene

This gene is overexpressed in Adrenal Gland (x7.6).

Protein differential expression in normal tissues from HIPED for FADS2 Gene

This gene is overexpressed in Breast (37.0), Adrenal (9.0), Fetal testis (7.2), and Fetal ovary (6.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for FADS2 Gene



Protein tissue co-expression partners for FADS2 Gene

NURSA nuclear receptor signaling pathways regulating expression of FADS2 Gene:

FADS2

SOURCE GeneReport for Unigene cluster for FADS2 Gene:

Hs.502745

mRNA Expression by UniProt/SwissProt for FADS2 Gene:

O95864-FADS2_HUMAN
Tissue specificity: Expressed in a wide array of tissues, highest expression is found in liver followed by brain, lung, heart, and retina. A lower level is found in breast tumor when compared with normal tissues; lowest levels were found in patients with poor prognostic index.

Evidence on tissue expression from TISSUES for FADS2 Gene

  • Nervous system(4.9)
  • Skin(4.6)
  • Liver(3.6)
  • Eye(2.4)
  • Kidney(2.4)
  • Muscle(2.4)
  • Lung(2.3)
  • Adrenal gland(2.2)
  • Blood(2.1)
  • Intestine(2)
genes like me logo Genes that share expression patterns with FADS2: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for FADS2 Gene

Orthologs for FADS2 Gene

This gene was present in the common ancestor of animals.

Orthologs for FADS2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FADS2 33 32
  • 99.77 (n)
OneToOne
dog
(Canis familiaris)
Mammalia FADS2 33 32
  • 90.35 (n)
OneToOne
cow
(Bos Taurus)
Mammalia FADS2 33 32
  • 89.64 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 33
  • 89 (a)
OneToMany
-- 33
  • 78 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia Fads2 32
  • 87.31 (n)
mouse
(Mus musculus)
Mammalia Fads2 17 33 32
  • 87.24 (n)
oppossum
(Monodelphis domestica)
Mammalia FADS2 33
  • 75 (a)
OneToOne
chicken
(Gallus gallus)
Aves FADS2 33 32
  • 74.92 (n)
OneToMany
lizard
(Anolis carolinensis)
Reptilia -- 33
  • 73 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia fads2 32
  • 70.86 (n)
African clawed frog
(Xenopus laevis)
Amphibia MGC68735 32
zebrafish
(Danio rerio)
Actinopterygii fads2 33 32 32
  • 67.19 (n)
OneToMany
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.11040 32
worm
(Caenorhabditis elegans)
Secernentea fat-3 33 34 32
  • 43.83 (n)
ManyToMany
fat-4 33
  • 22 (a)
ManyToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 26 (a)
OneToMany
Species where no ortholog for FADS2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for FADS2 Gene

ENSEMBL:
Gene Tree for FADS2 (if available)
TreeFam:
Gene Tree for FADS2 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for FADS2: view image

Paralogs for FADS2 Gene

Paralogs for FADS2 Gene

(3) SIMAP similar genes for FADS2 Gene using alignment to 9 proteins:

  • FADS2_HUMAN
  • B7Z634_HUMAN
  • E5RGD8_HUMAN
  • E5RGZ5_HUMAN
  • E5RHL3_HUMAN
  • F5GZ92_HUMAN
  • F5GZU2_HUMAN
  • F5H622_HUMAN
  • L8E950_HUMAN

Pseudogenes.org Pseudogenes for FADS2 Gene

genes like me logo Genes that share paralogs with FADS2: view

Variants for FADS2 Gene

Sequence variations from dbSNP and Humsavar for FADS2 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs66698963 not-provided, not provided 61,835,025(+) CTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGG/CTCCCTGCCTCCCCAGGG/CTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGG intron_variant
rs1000027467 -- 61,828,987(+) C/T intron_variant
rs1000068847 -- 61,847,594(+) G/A intron_variant
rs1000085757 -- 61,850,818(+) C/T intron_variant
rs1000190245 -- 61,818,959(+) C/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for FADS2 Gene

Variant ID Type Subtype PubMed ID
esv2670536 CNV deletion 23128226
nsv1122627 CNV deletion 24896259
nsv468585 CNV loss 19166990
nsv528697 CNV loss 19592680
nsv555171 CNV loss 21841781

Variation tolerance for FADS2 Gene

Residual Variation Intolerance Score: 11.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.22; 4.95% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for FADS2 Gene

Human Gene Mutation Database (HGMD)
FADS2
SNPedia medical, phenotypic, and genealogical associations of SNPs for
FADS2

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FADS2 Gene

Disorders for FADS2 Gene

MalaCards: The human disease database

(3) MalaCards diseases for FADS2 Gene - From: HGMD, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search FADS2 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for FADS2

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with FADS2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for FADS2 Gene

Publications for FADS2 Gene

  1. Identification of the delta-6 desaturase of human sebaceous glands: expression and enzyme activity. (PMID: 12713571) Ge L … Prouty SM (The Journal of investigative dermatology 2003) 3 4 23 26 56
  2. Role of FADS1 and FADS2 polymorphisms in polyunsaturated fatty acid metabolism. (PMID: 20045144) Glaser C … Koletzko B (Metabolism: clinical and experimental 2010) 3 23 43 56
  3. Genetic variants of the FADS1 FADS2 gene cluster as related to essential fatty acid metabolism. (PMID: 19809313) Lattka E … Heinrich J (Current opinion in lipidology 2010) 3 23 43 56
  4. Genome-wide association study of plasma polyunsaturated fatty acids in the InCHIANTI Study. (PMID: 19148276) Tanaka T … Ferrucci L (PLoS genetics 2009) 3 23 43 56
  5. SNPs of the FADS gene cluster are associated with polyunsaturated fatty acids in a cohort of patients with cardiovascular disease. (PMID: 18320251) Malerba G … Illig T (Lipids 2008) 3 23 43 56

Products for FADS2 Gene

Sources for FADS2 Gene