Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The ... See more...

Aliases for EPHB1 Gene

Aliases for EPHB1 Gene

  • EPH Receptor B1 2 3 5
  • Neuronally-Expressed EPH-Related Tyrosine Kinase 3 4
  • Tyrosine-Protein Kinase Receptor EPH-2 3 4
  • Ephrin Type-B Receptor 1 3 4
  • EPH-Like Kinase 6 3 4
  • EC 4 54
  • EPHT2 3 4
  • HEK6 4 4
  • EK6 3 4
  • ELK 3 4
  • NET 3 4
  • Soluble EPHB1 Variant 1 3
  • Eph Tyrosine Kinase 2 3
  • EPH Tyrosine Kinase 2 4
  • EC 2.7.10 54
  • EphB1 2
  • Hek6 3

External Ids for EPHB1 Gene

Previous HGNC Symbols for EPHB1 Gene

  • EPHT2

Previous GeneCards Identifiers for EPHB1 Gene

  • GC03M131897
  • GC03P135607
  • GC03P135795
  • GC03P135835
  • GC03P135996
  • GC03P134316
  • GC03P131890

Summaries for EPHB1 Gene

Entrez Gene Summary for EPHB1 Gene

  • Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]

GeneCards Summary for EPHB1 Gene

EPHB1 (EPH Receptor B1) is a Protein Coding gene. Diseases associated with EPHB1 include Myopathy, Myofibrillar, 7 and Ovary Serous Adenocarcinoma. Among its related pathways are EPH-Ephrin signaling and MAPK-Erk Pathway. Gene Ontology (GO) annotations related to this gene include transferase activity, transferring phosphorus-containing groups and protein tyrosine kinase activity. An important paralog of this gene is EPHB2.

UniProtKB/Swiss-Prot Summary for EPHB1 Gene

  • Receptor tyrosine kinase which binds promiscuously transmembrane ephrin-B family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Cognate/functional ephrin ligands for this receptor include EFNB1, EFNB2 and EFNB3. During nervous system development, regulates retinal axon guidance redirecting ipsilaterally ventrotemporal retinal ganglion cells axons at the optic chiasm midline. This probably requires repulsive interaction with EFNB2. In the adult nervous system together with EFNB3, regulates chemotaxis, proliferation and polarity of the hippocampus neural progenitors. In addition to its role in axon guidance plays also an important redundant role with other ephrin-B receptors in development and maturation of dendritic spines and synapse formation. May also regulate angiogenesis. More generally, may play a role in targeted cell migration and adhesion. Upon activation by EFNB1 and probably other ephrin-B ligands activates the MAPK/ERK and the JNK signaling cascades to regulate cell migration and adhesion respectively. Involved in the maintenance of the pool of satellite cells (muscle stem cells) by promoting their self-renewal and reducing their activation and differentiation (By similarity).

Tocris Summary for EPHB1 Gene

  • Eph receptors are the largest family of receptor tyrosine kinases (RTKs) and are divided into two subclasses, EphA and EphB. Originally identified as mediators of axon guidance, Eph receptors are implicated in many processes, particularly cancer development and progression.

Gene Wiki entry for EPHB1 Gene

Additional gene information for EPHB1 Gene

No data available for CIViC Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for EPHB1 Gene

Genomics for EPHB1 Gene

GeneHancer (GH) Regulatory Elements for EPHB1 Gene

Promoters and enhancers for EPHB1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J134795 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas 750.1 +198.5 198479 2.6 ZNF785 ZNF24 CTCF ZBTB6 CTBP1 ZFP41 ZNF121 RAD21 SP1 NKRF ENSG00000286982 EPHB1 ENSG00000249691 RYK HMGB3P14 RPL39P5 RNA5SP141 RF00001-226
GH03J134597 Enhancer 1 FANTOM5 Ensembl ENCODE 750.6 +0.4 400 3.2 MNT FOSL2 ZIC2 RFX1 CTBP1 FOXA2 CTCF MAZ FOXA1 FOS EPHB1 lnc-EPHB1-1 ANAPC13 CEP63 lnc-KY-3
GH03J134809 Enhancer 0.8 Ensembl ENCODE 38.4 +212.4 212400 2 SP1 PRDM1 IKZF1 IKZF2 DPF2 BMI1 NBN TAL1 SIN3A ATF7 EPHB1 piR-37310 ENSG00000286982
GH03J134802 Enhancer 0.6 ENCODE 19.1 +205.2 205234 0.8 MLLT1 RELA IKZF1 IKZF2 DPF2 ELF1 BCL11A RUNX3 BMI1 NR2F1 EPHB1 ENSG00000286982 piR-37310
GH03J134788 Enhancer 0.3 Ensembl 32.7 +192.0 191999 2 POLR2A EPHB1 ENSG00000286982 RNA5SP141 RF00001-226
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around EPHB1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the EPHB1 gene promoter:
  • AREB6
  • Arnt
  • CUTL1
  • HOXA5
  • NF-kappaB1
  • Nkx2-5
  • Spz1
  • SRF
  • SRF (504 AA)
  • STAT5A

Genomic Locations for EPHB1 Gene

Genomic Locations for EPHB1 Gene
662,667 bases
Plus strand
662,667 bases
Plus strand

Genomic View for EPHB1 Gene

Genes around EPHB1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
EPHB1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for EPHB1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for EPHB1 Gene

Proteins for EPHB1 Gene

  • Protein details for EPHB1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Ephrin type-B receptor 1
    Protein Accession:
    Secondary Accessions:
    • A8K593
    • B3KTB2
    • B5A969
    • O43569
    • O95142
    • O95143
    • Q0VG87

    Protein attributes for EPHB1 Gene

    984 amino acids
    Molecular mass:
    109885 Da
    Quaternary structure:
    • Heterotetramer upon binding of the ligand. The heterotetramer is composed of an ephrin dimer and a receptor dimer. Oligomerization is probably required to induce biological responses (By similarity). Interacts with EPHB6; transphosphorylates EPHB6 to form an active signaling complex. Interacts with PICK1 (By similarity). Interacts (through Tyr-594) with NCK1 (via SH2 domain); activates the JUN cascade to regulate cell adhesion (By similarity). The ligand-activated form interacts (through Tyr-928) with GRB7 and GRB10 (via SH2 domains). The ligand-activated form interacts (residues within the catalytic domain) with GRB2 (via SH2 domain). Interacts with GRB2, SHC1 and SRC; activates the MAPK/ERK cascade to regulate cell migration. Interacts with CBL; regulates receptor degradation through ubiquitination. Interacts with ACP1.
    • Sequence=AAB94627.1; Type=Miscellaneous discrepancy; Note=wrong intron-exon boundaries.; Evidence={ECO:0000305}; Sequence=AAB94628.1; Type=Miscellaneous discrepancy; Note=wrong intron-exon boundaries.; Evidence={ECO:0000305}; Sequence=AAD02031.1; Type=Miscellaneous discrepancy; Note=Chimeric cDNA.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for EPHB1 Gene

    Alternative splice isoforms for EPHB1 Gene


neXtProt entry for EPHB1 Gene

Selected DME Specific Peptides for EPHB1 Gene


Post-translational modifications for EPHB1 Gene

  • Phosphorylated. Autophosphorylation is stimulated by the ligand EFNB1. Required for interaction with SH2 domain-containing interactors, for activation of the MAPK/ERK and JUN signaling cascades and for ubiquitination by CBL.
  • Ubiquitinated; (EFNB1)ligand-induced poly- and/or multi-ubiquitination by CBL is regulated by SRC and leads to lysosomal degradation.
  • Glycosylation at Asn480, Asn334, and Asn426
  • Modification sites at PhosphoSitePlus

Antibody Products

Domains & Families for EPHB1 Gene

Gene Families for EPHB1 Gene

Suggested Antigen Peptide Sequences for EPHB1 Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ37986 fis, clone CTONG2011188, highly similar to Ephrin type-B receptor 1 (EC (B3KTB2_HUMAN)
  • Soluble EPHB1 variant 1 (B5A969_HUMAN)
  • Tyrosine-protein kinase receptor EPH-2 (EPHB1_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the protein kinase superfamily. Tyr protein kinase family. Ephrin receptor subfamily.
  • Belongs to the protein kinase superfamily. Tyr protein kinase family. Ephrin receptor subfamily.
genes like me logo Genes that share domains with EPHB1: view

Function for EPHB1 Gene

Molecular function for EPHB1 Gene

UniProtKB/Swiss-Prot Function:
Receptor tyrosine kinase which binds promiscuously transmembrane ephrin-B family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Cognate/functional ephrin ligands for this receptor include EFNB1, EFNB2 and EFNB3. During nervous system development, regulates retinal axon guidance redirecting ipsilaterally ventrotemporal retinal ganglion cells axons at the optic chiasm midline. This probably requires repulsive interaction with EFNB2. In the adult nervous system together with EFNB3, regulates chemotaxis, proliferation and polarity of the hippocampus neural progenitors. In addition to its role in axon guidance plays also an important redundant role with other ephrin-B receptors in development and maturation of dendritic spines and synapse formation. May also regulate angiogenesis. More generally, may play a role in targeted cell migration and adhesion. Upon activation by EFNB1 and probably other ephrin-B ligands activates the MAPK/ERK and the JNK signaling cascades to regulate cell migration and adhesion respectively. Involved in the maintenance of the pool of satellite cells (muscle stem cells) by promoting their self-renewal and reducing their activation and differentiation (By similarity).
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=ATP + L-tyrosyl-[protein] = ADP + H(+) + O-phospho-L-tyrosyl-[protein]; Xref=Rhea:RHEA:10596, Rhea:RHEA-COMP:10136, Rhea:RHEA-COMP:10137, ChEBI:CHEBI:15378, ChEBI:CHEBI:30616, ChEBI:CHEBI:46858, ChEBI:CHEBI:82620, ChEBI:CHEBI:456216; EC=; Evidence=. ;.
GENATLAS Biochemistry:
EPH-related tyrosine kinase receptor,binding ephrins B1,B2,expressed in projecting neurons and their target fields,involved in short-range contact-mediated axonal guidance

Enzyme Numbers (IUBMB) for EPHB1 Gene

Phenotypes From GWAS Catalog for EPHB1 Gene

Gene Ontology (GO) - Molecular Function for EPHB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004672 protein kinase activity IEA --
GO:0004713 protein tyrosine kinase activity IEA --
GO:0004714 transmembrane receptor protein tyrosine kinase activity IBA 21873635
GO:0005003 ephrin receptor activity IEA --
GO:0005005 transmembrane-ephrin receptor activity IDA,IBA 18034775
genes like me logo Genes that share ontologies with EPHB1: view
genes like me logo Genes that share phenotypes with EPHB1: view

Animal Models for EPHB1 Gene

MGI Knock Outs for EPHB1:

Animal Model Products

CRISPR Products

Clone Products

  • Addgene plasmids for EPHB1

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for EPHB1 Gene

Localization for EPHB1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for EPHB1 Gene

Cell membrane; Single-pass type I membrane protein. Early endosome membrane. Cell projection, dendrite.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for EPHB1 gene
Compartment Confidence
plasma membrane 5
endosome 5
extracellular 4
endoplasmic reticulum 4
cytosol 4
cytoskeleton 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Plasma membrane (3)
  • Cytosol (2)
  • Endoplasmic reticulum (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for EPHB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005737 cytoplasm IEA --
GO:0005768 endosome IEA --
GO:0005783 endoplasmic reticulum IDA --
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with EPHB1: view

Pathways & Interactions for EPHB1 Gene

PathCards logo

SuperPathways for EPHB1 Gene

SuperPathway Contained pathways
1 GPCR Pathway
2 EPH-Ephrin signaling
3 ERK Signaling
4 Nanog in Mammalian ESC Pluripotency
5 MAPK-Erk Pathway
genes like me logo Genes that share pathways with EPHB1: view

Pathways by source for EPHB1 Gene

31 Qiagen pathways for EPHB1 Gene
  • 14-3-3 Induced Intracellular Signaling
  • Actin Nucleation and Branching
  • Actin Nucleation by ARP-WASP Complex
  • Activation of cAMP-Dependent PKA
  • Activation of PKA through GPCR
2 Cell Signaling Technology pathways for EPHB1 Gene

SIGNOR curated interactions for EPHB1 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for EPHB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001525 angiogenesis IDA 9499402
GO:0001771 immunological synapse formation IEA --
GO:0006468 protein phosphorylation IEA --
GO:0007155 cell adhesion IEA --
GO:0007169 transmembrane receptor protein tyrosine kinase signaling pathway IBA 21873635
genes like me logo Genes that share ontologies with EPHB1: view

Drugs & Compounds for EPHB1 Gene

(3) Drugs for EPHB1 Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
fostamatinib Approved, Investigational Pharma Target, inhibitor Kinase Inhibitors 0
ATP Investigational Nutra Agonist, Activator, Full agonist, Antagonist, Pore Blocker, Potentiation 0

(2) Additional Compounds for EPHB1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • 5'-Adenylphosphoric acid
  • Adenosine 5'-diphosphate
  • ADENOSINE-5'-diphosphATE
  • H3ADP
  • 5'-Adenylphosphate
Full agonist, Agonist, Partial agonist, Antagonist, Gating inhibitor 58-64-0
genes like me logo Genes that share compounds with EPHB1: view

Transcripts for EPHB1 Gene

mRNA/cDNA for EPHB1 Gene

CRISPR Products

Clone Products

  • Addgene plasmids for EPHB1

Alternative Splicing Database (ASD) splice patterns (SP) for EPHB1 Gene

No ASD Table

Relevant External Links for EPHB1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for EPHB1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for EPHB1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for EPHB1 Gene

This gene is overexpressed in Brain - Cerebellar Hemisphere (x6.0) and Brain - Cerebellum (x4.6).

Protein differential expression in normal tissues from HIPED for EPHB1 Gene

This gene is overexpressed in Lavage (58.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for EPHB1 Gene

NURSA nuclear receptor signaling pathways regulating expression of EPHB1 Gene:


SOURCE GeneReport for Unigene cluster for EPHB1 Gene:


mRNA Expression by UniProt/SwissProt for EPHB1 Gene:

Tissue specificity: Preferentially expressed in brain.

Evidence on tissue expression from TISSUES for EPHB1 Gene

  • Nervous system(4.9)
  • Kidney(4.1)
  • Eye(2)
genes like me logo Genes that share expression patterns with EPHB1: view

No data available for Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for EPHB1 Gene

Orthologs for EPHB1 Gene

This gene was present in the common ancestor of animals.

Orthologs for EPHB1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia EPHB1 33 32
  • 99.73 (n)
(Monodelphis domestica)
Mammalia EPHB1 33
  • 97 (a)
(Bos Taurus)
Mammalia EPHB1 33 32
  • 93.09 (n)
(Canis familiaris)
Mammalia EPHB1 33 32
  • 92.92 (n)
(Rattus norvegicus)
Mammalia Ephb1 32
  • 91.57 (n)
(Mus musculus)
Mammalia Ephb1 17 33 32
  • 91.33 (n)
(Gallus gallus)
Aves EPHB1 33 32
  • 84.42 (n)
(Anolis carolinensis)
Reptilia EPHB1 33
  • 93 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ephb1 32
  • 78.8 (n)
Str.11068 32
African clawed frog
(Xenopus laevis)
Amphibia Xl.1028 32
(Danio rerio)
Actinopterygii EPHB1 33
  • 85 (a)
ephb1 32
  • 76.68 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000489 32
  • 54.65 (n)
fruit fly
(Drosophila melanogaster)
Insecta Eph 33 34 32
  • 49.39 (n)
hop 34
  • 38 (a)
(Caenorhabditis elegans)
Secernentea T25B9.5 34
  • 34 (a)
F59A3.8 34
  • 33 (a)
old-1 34
  • 33 (a)
old-2 34
  • 33 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 44 (a)
CSA.7809 33
  • 43 (a)
-- 33
  • 42 (a)
CSA.1664 33
  • 39 (a)
Species where no ortholog for EPHB1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for EPHB1 Gene

Gene Tree for EPHB1 (if available)
Gene Tree for EPHB1 (if available)
Evolutionary constrained regions (ECRs) for EPHB1: view image

Paralogs for EPHB1 Gene

genes like me logo Genes that share paralogs with EPHB1: view

Variants for EPHB1 Gene

Sequence variations from dbSNP and Humsavar for EPHB1 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1085307110 pathogenic, Hereditary spastic paraplegia 134,650,910(+) /ATGTCGATAGATACAGCACATGTCGATA genic_upstream_transcript_variant, intron_variant
rs1338928289 A gastric adenocarcinoma sample 135,201,571(+) G/A coding_sequence_variant, missense_variant
rs377332009 pathogenic, Myopathy, myofibrillar, 7 134,625,131(+) G/A/T genic_upstream_transcript_variant, intron_variant
rs886037917 pathogenic, Myopathy, myofibrillar, 7 134,608,668(+) C/ genic_upstream_transcript_variant, intron_variant
VAR_042167 An ovarian undifferentiated carcinoma sample p.Ser707Thr

Structural Variations from Database of Genomic Variants (DGV) for EPHB1 Gene

Variant ID Type Subtype PubMed ID
dgv2606n106 CNV deletion 24896259
dgv939e214 CNV gain 21293372
esv22232 CNV loss 19812545
esv2309200 CNV deletion 18987734
esv2421444 CNV deletion 20811451
esv2490314 CNV deletion 19546169
esv2660214 CNV deletion 23128226
esv2663866 CNV deletion 23128226
esv2677066 CNV deletion 23128226
esv2725955 CNV deletion 23290073
esv2760811 CNV loss 21179565
esv2833680 CNV deletion 24192839
esv29010 CNV gain 19812545
esv3562589 CNV deletion 23714750
esv3562592 CNV deletion 23714750
esv3597860 CNV loss 21293372
esv3597861 CNV gain 21293372
esv3597864 CNV gain 21293372
esv3597865 CNV gain 21293372
esv3597866 CNV loss 21293372
esv3597867 CNV gain 21293372
esv3597868 CNV gain 21293372
esv991539 CNV deletion 20482838
nsv1000277 CNV gain 25217958
nsv1074627 CNV deletion 25765185
nsv1145941 CNV duplication 26484159
nsv1148781 CNV deletion 26484159
nsv4020 CNV insertion 18451855
nsv436394 CNV deletion 17901297
nsv441840 CNV loss 18776908
nsv460859 CNV loss 19166990
nsv478891 CNV novel sequence insertion 20440878
nsv508956 CNV insertion 20534489
nsv513075 CNV loss 21212237
nsv514169 CNV loss 21397061
nsv519871 CNV loss 19592680
nsv520932 CNV loss 19592680
nsv818168 CNV loss 17921354
nsv822262 CNV loss 20364138
nsv829731 CNV loss 17160897

Variation tolerance for EPHB1 Gene

Residual Variation Intolerance Score: 5.11% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.09; 38.17% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for EPHB1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for EPHB1 Gene

Disorders for EPHB1 Gene

MalaCards: The human disease database

(2) MalaCards diseases for EPHB1 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
myopathy, myofibrillar, 7
  • mfm7
ovary serous adenocarcinoma
  • malignant ovarian serous tumor
- elite association - COSMIC cancer census association via MalaCards
Search EPHB1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for EPHB1

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with EPHB1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for EPHB1 Gene

Publications for EPHB1 Gene

  1. cDNA cloning, molecular characterization, and chromosomal localization of NET(EPHT2), a human EPH-related receptor protein-tyrosine kinase gene preferentially expressed in brain. (PMID: 8666391) Tang XX … Ikegaki N (Genomics 1995) 2 3 4 23 56
  2. Ligand binding induces Cbl-dependent EphB1 receptor degradation through the lysosomal pathway. (PMID: 18034775) Fasen K … Huynh-Do U (Traffic (Copenhagen, Denmark) 2008) 3 4 23 56
  3. EphB1 recruits c-Src and p52Shc to activate MAPK/ERK and promote chemotaxis. (PMID: 12925710) Vindis C … Huynh-Do U (The Journal of cell biology 2003) 3 4 23 56
  4. The kinase-null EphB6 receptor undergoes transphosphorylation in a complex with EphB1. (PMID: 11713248) Freywald A … Roifman CM (The Journal of biological chemistry 2002) 3 4 23 56
  5. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 43 56

Products for EPHB1 Gene

Sources for EPHB1 Gene