This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated with autosomal recessive distal arthrogryposis, type 5D. This gene has multiple pseudogenes on chromosome 2. Alternative spl... See more...

Aliases for ECEL1 Gene

Aliases for ECEL1 Gene

  • Endothelin Converting Enzyme Like 1 2 3 5
  • Damage Induced Neuronal Endopeptidase 2 3
  • Endothelin-Converting Enzyme-Like 1 3 4
  • XCE 3 4
  • X Converting Enzyme 3
  • EC 54
  • Xce Protein 4
  • EC 3.4.24.- 4
  • EC 3.4.24 54
  • DA5D 3
  • DINE 3
  • ECEX 3

External Ids for ECEL1 Gene

Previous GeneCards Identifiers for ECEL1 Gene

  • GC02M231401
  • GC02M232073
  • GC02M233308
  • GC02M233547
  • GC02M233170
  • GC02M233052
  • GC02M225195

Summaries for ECEL1 Gene

Entrez Gene Summary for ECEL1 Gene

  • This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated with autosomal recessive distal arthrogryposis, type 5D. This gene has multiple pseudogenes on chromosome 2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]

GeneCards Summary for ECEL1 Gene

ECEL1 (Endothelin Converting Enzyme Like 1) is a Protein Coding gene. Diseases associated with ECEL1 include Arthrogryposis, Distal, Type 5D and Distal Arthrogryposis. Gene Ontology (GO) annotations related to this gene include metalloendopeptidase activity and metallopeptidase activity. An important paralog of this gene is ECE1.

UniProtKB/Swiss-Prot Summary for ECEL1 Gene

  • May contribute to the degradation of peptide hormones and be involved in the inactivation of neuronal peptides.

Gene Wiki entry for ECEL1 Gene

Additional gene information for ECEL1 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for ECEL1 Gene

Genomics for ECEL1 Gene

GeneHancer (GH) Regulatory Elements for ECEL1 Gene

Promoters and enhancers for ECEL1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02J232487 Promoter 1 EPDnew Ensembl 759.9 +0.2 159 0.6 POLR2A EZH2 SCRT2 ZFHX2 ZNF398 ZBTB12 ECEL1 HSALNG0023039 lnc-ALPI-3
GH02J232488 Enhancer 0.3 FANTOM5 814.5 -0.7 -715 0.3 CTCF ECEL1 HSALNG0023039 PRSS56
GH02J232432 Enhancer 0.8 Ensembl ENCODE dbSUPER 15.6 +54.5 54538 2.2 CTCF ZSCAN21 ZIC2 PRDM10 ZBTB17 ZSCAN16 ZNF48 ECEL1 ECEL1P2 DIS3L2P1 piR-48049-045
GH02J232650 Enhancer 1 Ensembl ENCODE dbSUPER 10.3 -164.7 -164703 3.5 SP1 CEBPG SP7 ZIC2 CEBPA TCF7L2 PRDM10 LEF1 CTBP1 POLR2A ENSG00000237126 GIGYF2 KCNJ13 ECEL1 SAG EFHD1 RN7SL359P RF00017-3459 lnc-GIGYF2-3 RF01210-231
GH02J232572 Enhancer 1 Ensembl ENCODE 10.5 -86.2 -86228 2.7 FOXA1 MIXL1 HLF ELF3 AHR SP1 CEBPG PPARG ZNF644 KAT8 NONHSAG030797.2 EIF4E2 TIGD1 ECEL1 GIGYF2
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ECEL1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ECEL1 gene promoter:
  • GATA-1
  • LCR-F1
  • Lhx3a
  • LHX3b
  • LUN-1
  • Pax-3
  • Pax-5
  • Sox9
  • USF-1
  • USF1

Genomic Locations for ECEL1 Gene

Genomic Locations for ECEL1 Gene
8,033 bases
Minus strand
8,002 bases
Minus strand

Genomic View for ECEL1 Gene

Genes around ECEL1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ECEL1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ECEL1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ECEL1 Gene

Proteins for ECEL1 Gene

  • Protein details for ECEL1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Endothelin-converting enzyme-like 1
    Protein Accession:
    Secondary Accessions:
    • Q45UD9
    • Q53RF9
    • Q6UW86
    • Q86TH4
    • Q9NY95

    Protein attributes for ECEL1 Gene

    775 amino acids
    Molecular mass:
    87791 Da
    Name=Zn(2+); Xref=ChEBI:CHEBI:29105;
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for ECEL1 Gene


neXtProt entry for ECEL1 Gene

Selected DME Specific Peptides for ECEL1 Gene


Post-translational modifications for ECEL1 Gene

Other Protein References for ECEL1 Gene

Domains & Families for ECEL1 Gene

Gene Families for ECEL1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for ECEL1 Gene

GenScript: Design optimal peptide antigens:
  • Xce protein (ECEL1_HUMAN)
  • Endotheline-converting enzyme ECEL1 (Q86SN0_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the peptidase M13 family.
  • Belongs to the peptidase M13 family.
genes like me logo Genes that share domains with ECEL1: view

Function for ECEL1 Gene

Molecular function for ECEL1 Gene

UniProtKB/Swiss-Prot Function:
May contribute to the degradation of peptide hormones and be involved in the inactivation of neuronal peptides.

Enzyme Numbers (IUBMB) for ECEL1 Gene

Phenotypes From GWAS Catalog for ECEL1 Gene

Gene Ontology (GO) - Molecular Function for ECEL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004222 metalloendopeptidase activity IEA --
GO:0008233 peptidase activity IEA --
GO:0008237 metallopeptidase activity TAS 9931490
GO:0016787 hydrolase activity IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with ECEL1: view
genes like me logo Genes that share phenotypes with ECEL1: view

Human Phenotype Ontology for ECEL1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ECEL1 Gene

MGI Knock Outs for ECEL1:

Animal Model Products

CRISPR Products

miRNA for ECEL1 Gene

miRTarBase miRNAs that target ECEL1

Clone Products

No data available for Transcription Factor Targets and HOMER Transcription for ECEL1 Gene

Localization for ECEL1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ECEL1 Gene

Membrane; Single-pass type II membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ECEL1 gene
Compartment Confidence
plasma membrane 4
nucleus 1
cytosol 1
mitochondrion 0
peroxisome 0
endoplasmic reticulum 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear membrane (2)
  • Nucleoli (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ECEL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005887 integral component of plasma membrane TAS 9931490
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with ECEL1: view

Pathways & Interactions for ECEL1 Gene

PathCards logo

SuperPathways for ECEL1 Gene

No Data Available

Interacting Proteins for ECEL1 Gene

Gene Ontology (GO) - Biological Process for ECEL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003016 respiratory system process ISS --
GO:0006508 proteolysis IEA --
GO:0007218 neuropeptide signaling pathway IEA,TAS --
genes like me logo Genes that share ontologies with ECEL1: view

No data available for Pathways by source and SIGNOR curated interactions for ECEL1 Gene

Drugs & Compounds for ECEL1 Gene

(1) Drugs for ECEL1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with ECEL1: view

Transcripts for ECEL1 Gene

mRNA/cDNA for ECEL1 Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ECEL1 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8a · 8b ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19a · 19b · 19c
SP2: - -
SP4: -

Relevant External Links for ECEL1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ECEL1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ECEL1 Gene

mRNA differential expression in normal tissues according to GTEx for ECEL1 Gene

This gene is overexpressed in Ovary (x18.3), Brain - Hypothalamus (x12.7), and Pituitary (x5.2).

Protein differential expression in normal tissues from HIPED for ECEL1 Gene

This gene is overexpressed in Pancreatic juice (54.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ECEL1 Gene

NURSA nuclear receptor signaling pathways regulating expression of ECEL1 Gene:


SOURCE GeneReport for Unigene cluster for ECEL1 Gene:


mRNA Expression by UniProt/SwissProt for ECEL1 Gene:

Tissue specificity: Highly expressed in the CNS, in particular in putamen, spinal cord, medulla and subthalamic nucleus. A strong signal was also detected in uterine subepithelial cells and around renal blood vessels. Detected at lower levels in amygdala, caudate, thalamus, pancreas and skeletal muscle. Detected at very low levels in substantia nigra, cerebellum, cortex, corpus callosum and hippocampus.

Evidence on tissue expression from TISSUES for ECEL1 Gene

  • Nervous system(4.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ECEL1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • digestive
  • integumentary
  • nervous
  • skeletal muscle
  • skeleton
Head and neck:
  • cheek
  • chin
  • face
  • forehead
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • skull
  • tongue
  • ankle
  • arm
  • digit
  • elbow
  • finger
  • foot
  • hand
  • hip
  • knee
  • lower limb
  • shoulder
  • toe
  • upper limb
  • wrist
  • hair
  • skin
  • spinal column
genes like me logo Genes that share expression patterns with ECEL1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and Protein tissue co-expression partners for ECEL1 Gene

Orthologs for ECEL1 Gene

This gene was present in the common ancestor of animals.

Orthologs for ECEL1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ECEL1 33 32
  • 99.12 (n)
(Canis familiaris)
Mammalia ECEL1 33 32
  • 92.09 (n)
(Bos Taurus)
Mammalia ECEL1 33 32
  • 90.49 (n)
(Rattus norvegicus)
Mammalia Ecel1 32
  • 88.98 (n)
(Mus musculus)
Mammalia Ecel1 17 33 32
  • 88.8 (n)
(Monodelphis domestica)
Mammalia ECEL1 33
  • 87 (a)
(Ornithorhynchus anatinus)
Mammalia ECEL1 33
  • 87 (a)
(Gallus gallus)
Aves ECEL1 33 32
  • 78.68 (n)
(Anolis carolinensis)
Reptilia -- 33
  • 79 (a)
-- 33
  • 60 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ecel1 32
  • 68.5 (n)
(Danio rerio)
Actinopterygii ECEL1 33
  • 67 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG6265 34
  • 43 (a)
Nep1 34
  • 35 (a)
Nep2 34
  • 34 (a)
Nep4 34
  • 33 (a)
BcDNA:GH07188 34
  • 28 (a)
CG15485 33
  • 26 (a)
CG14526 33
  • 24 (a)
CG14527 33 34
  • 24 (a)
CG3775 33
  • 24 (a)
CG14528 33 34
  • 23 (a)
CG14529 33
  • 23 (a)
CG4721 33 34
  • 21 (a)
CG4725 33
  • 21 (a)
CG8358 33 34
  • 21 (a)
CG5527 33 34
  • 21 (a)
Nep5 33
  • 21 (a)
CG9507 33
  • 20 (a)
CG42370 33
  • 20 (a)
CG4723 33
  • 20 (a)
CG3239 33
  • 19 (a)
CG14523 33 34
  • 19 (a)
CG9505 33
  • 17 (a)
CG8550 33
  • 17 (a)
CG4580 33
  • 16 (a)
CG31918 33
  • 15 (a)
CG9634 33
  • 15 (a)
(Caenorhabditis elegans)
Secernentea T05A8.4 34
  • 34 (a)
T16A9.4 34
  • 32 (a)
F26G1.6 34
  • 28 (a)
F54F11.2 34
  • 26 (a)
F18A12.1 34
  • 24 (a)
T25B6.2 34
  • 24 (a)
nep-26 33
  • 23 (a)
K02F6.9 34
  • 23 (a)
C49D10.10 34
  • 22 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 32 (a)
Species where no ortholog for ECEL1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ECEL1 Gene

Gene Tree for ECEL1 (if available)
Gene Tree for ECEL1 (if available)
Evolutionary constrained regions (ECRs) for ECEL1: view image

Paralogs for ECEL1 Gene

Paralogs for ECEL1 Gene

(5) SIMAP similar genes for ECEL1 Gene using alignment to 3 proteins:

  • H7C3M0_HUMAN
  • Q86SN0_HUMAN Pseudogenes for ECEL1 Gene

genes like me logo Genes that share paralogs with ECEL1: view

Variants for ECEL1 Gene

Sequence variations from dbSNP and Humsavar for ECEL1 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1229171141 likely-pathogenic, Distal arthrogryposis type 5D 232,481,159(-) G/A/C intron_variant
rs1341894581 pathogenic, Distal arthrogryposis type 5D, Inborn genetic diseases 232,486,499(-) AGCCCGGACCGGGCCCCGGTGGCGCTGCGCGCAGCGCCCAACGGGAAGCCCGG/AGCCCGG coding_sequence_variant, frameshift
rs1356994386 likely-pathogenic, Distal arthrogryposis type 5D 232,486,653(-) T/A/C initiator_codon_variant, missense_variant
rs149459910 pathogenic, Distal arthrogryposis type 5D, not provided 232,483,452(-) C/T coding_sequence_variant, stop_gained
rs1529874 benign, not specified, - 232,484,878(-) G/A/C coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for ECEL1 Gene

Variant ID Type Subtype PubMed ID
nsv516082 CNV loss 19592680
nsv522450 CNV loss 19592680
nsv527789 CNV loss 19592680
nsv584694 CNV loss 21841781
nsv584695 CNV loss 21841781
nsv821918 CNV gain 20364138
nsv953202 CNV deletion 24416366

Variation tolerance for ECEL1 Gene

Residual Variation Intolerance Score: 38.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.34; 63.18% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ECEL1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ECEL1 Gene

Disorders for ECEL1 Gene

MalaCards: The human disease database

(8) MalaCards diseases for ECEL1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
arthrogryposis, distal, type 5d
  • da5d
distal arthrogryposis
  • freeman-sheldon syndrome
ovarian benign neoplasm
  • benign ovarian neoplasm
  • leuteoma of pregnancy
fissured tongue
  • congenital fissure of tongue
- elite association - COSMIC cancer census association via MalaCards
Search ECEL1 in MalaCards View complete list of genes associated with diseases


  • Arthrogryposis, distal, 5D (DA5D) [MIM:615065]: An autosomal recessive form of distal arthrogryposis, a disease characterized by congenital joint contractures that mainly involve two or more distal parts of the limbs, in the absence of a primary neurological or muscle disease. DA5D is characterized by severe camptodactyly of the hands, mild camptodactyly of the toes, clubfoot and/or a calcaneovalgus deformity, extension contractures of the knee, unilateral ptosis or ptosis that is more severe on one side, a round-shaped face, arched eyebrows, a bulbous upturned nose, and micrognathia. Patients do not have ophthalmoplegia. {ECO:0000269 PubMed:23236030, ECO:0000269 PubMed:23261301, ECO:0000269 PubMed:23808592, ECO:0000269 PubMed:23829171}. Note=The disease is caused by mutations affecting the gene represented in this entry. ECEL1 mutations have also been found in patients with arthrogryposis, significant ophthalmoplegia, and refractive errors (PubMed:23808592). {ECO:0000269 PubMed:23808592}.

Additional Disease Information for ECEL1

genes like me logo Genes that share disorders with ECEL1: view

No data available for Genatlas for ECEL1 Gene

Publications for ECEL1 Gene

  1. XCE, a new member of the endothelin-converting enzyme and neutral endopeptidase family, is preferentially expressed in the CNS. (PMID: 9931490) Valdenaire O … Schweizer A (Brain research. Molecular brain research 1999) 2 3 4 23 56
  2. Organization and chromosomal localization of the human ECEL1 (XCE) gene encoding a zinc metallopeptidase involved in the nervous control of respiration. (PMID: 10698686) Valdenaire O … Meijers C (The Biochemical journal 2000) 3 4 23 56
  3. Identification of three novel ECEL1 mutations in three families with distal arthrogryposis type 5D. (PMID: 23829171) Shaheen R … Alkuraya FS (Clinical genetics 2014) 3 4 56
  4. Expanding the phenotypic spectrum of ECEL1-related congenital contracture syndromes. (PMID: 23808592) Shaaban S … Engle EC (Clinical genetics 2014) 3 4 56
  5. The neuronal endopeptidase ECEL1 is associated with a distinct form of recessive distal arthrogryposis. (PMID: 23236030) Dieterich K … Lunardi J (Human molecular genetics 2013) 3 4 56

Products for ECEL1 Gene

Sources for ECEL1 Gene