Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DHRS1 Gene

Aliases for DHRS1 Gene

  • Dehydrogenase/Reductase 1 2 3 5
  • Short Chain Dehydrogenase/Reductase Family 19C Member 1 3 4
  • Dehydrogenase/Reductase (SDR Family) Member 1 2 3
  • SDR19C1 3 4
  • Short Chain Dehydrogenase/Reductase Family 19C, Member 1 2
  • Dehydrogenase/Reductase SDR Family Member 1 3
  • EC 1.1.-.- 4

External Ids for DHRS1 Gene

Previous GeneCards Identifiers for DHRS1 Gene

  • GC14M022132
  • GC14M018547
  • GC14M022749
  • GC14M023829
  • GC14M024759
  • GC14M004874

Summaries for DHRS1 Gene

Entrez Gene Summary for DHRS1 Gene

  • This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family. The encoded enzyme contains a conserved catalytic domain and likely functions as an oxidoreductase. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]

GeneCards Summary for DHRS1 Gene

DHRS1 (Dehydrogenase/Reductase 1) is a Protein Coding gene. Diseases associated with DHRS1 include Specific Language Impairment. Gene Ontology (GO) annotations related to this gene include oxidoreductase activity. An important paralog of this gene is HSDL2.

Gene Wiki entry for DHRS1 Gene

Additional gene information for DHRS1 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DHRS1 Gene

Genomics for DHRS1 Gene

GeneHancer (GH) Regulatory Elements for DHRS1 Gene

Promoters and enhancers for DHRS1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14J024298 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 665 +0.0 17 2.6 PKNOX1 ZFP64 ARID4B SIN3A DMAP1 YY1 SLC30A9 E2F8 ZNF143 FOS DHRS1 NOP9 LTB4R KHNYN RNA5SP383 TINF2 RNF31 TM9SF1 CIDEB TSSK4
GH14J024270 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE 18.9 +27.0 27007 5.4 MLX ZFP64 DMAP1 IRF4 SLC30A9 ZNF213 ZNF143 SP3 NFYC SSRP1 LOC102725044 RABGGTA IPO4 TSSK4 RNF31 HOMEZ KHNYN NOP9 NGDN DHRS1
GH14J024306 Promoter/Enhancer 1.5 EPDnew ENCODE 20.9 -7.8 -7753 2.5 HDGF FOXA2 MLX ZFP64 ARID4B DMAP1 ZNF48 ETS1 YY1 SLC30A9 CIDEB LTB4R2 DHRS1 LTB4R KHNYN RNA5SP383 TINF2 RNF31 TM9SF1 TSSK4
GH14J024309 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 13.5 -13.9 -13897 8.6 PKNOX1 MLX ARID4B DMAP1 YY1 SLC30A9 ZNF143 ZNF207 FOS PAF1 CIDEB LTB4R LTB4R2 KHNYN RNA5SP383 NGDN TM9SF1 RNF31 TINF2 NYNRIN
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around DHRS1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the DHRS1 gene promoter:

Genomic Locations for DHRS1 Gene

Genomic Locations for DHRS1 Gene
9,236 bases
Minus strand

Genomic View for DHRS1 Gene

Genes around DHRS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DHRS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DHRS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DHRS1 Gene

Proteins for DHRS1 Gene

  • Protein details for DHRS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Dehydrogenase/reductase SDR family member 1
    Protein Accession:
    Secondary Accessions:
    • D3DS71
    • Q8NDG3
    • Q96B59
    • Q96CQ5

    Protein attributes for DHRS1 Gene

    313 amino acids
    Molecular mass:
    33909 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for DHRS1 Gene

neXtProt entry for DHRS1 Gene

Post-translational modifications for DHRS1 Gene

  • Ubiquitination at Lys217 and Lys29
  • Modification sites at PhosphoSitePlus

Other Protein References for DHRS1 Gene

No data available for DME Specific Peptides for DHRS1 Gene

Domains & Families for DHRS1 Gene

Gene Families for DHRS1 Gene

Suggested Antigen Peptide Sequences for DHRS1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the short-chain dehydrogenases/reductases (SDR) family.
  • Belongs to the short-chain dehydrogenases/reductases (SDR) family.
genes like me logo Genes that share domains with DHRS1: view

Function for DHRS1 Gene

Enzyme Numbers (IUBMB) for DHRS1 Gene

Gene Ontology (GO) - Molecular Function for DHRS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16189514
GO:0016491 oxidoreductase activity IEA --
genes like me logo Genes that share ontologies with DHRS1: view
genes like me logo Genes that share phenotypes with DHRS1: view

Animal Model Products

  • Taconic Biosciences Mouse Models for DHRS1

miRNA for DHRS1 Gene

miRTarBase miRNAs that target DHRS1

Clone Products

  • Addgene plasmids for DHRS1

No data available for Molecular function , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for DHRS1 Gene

Localization for DHRS1 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DHRS1 gene
Compartment Confidence
endoplasmic reticulum 5
mitochondrion 3
nucleus 3
cytosol 3
cytoskeleton 2
plasma membrane 1
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Centrosome (2)
  • Cytosol (2)
  • Nucleus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for DHRS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005743 mitochondrial inner membrane IEA --
GO:0005783 endoplasmic reticulum IDA --
genes like me logo Genes that share ontologies with DHRS1: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for DHRS1 Gene

Pathways & Interactions for DHRS1 Gene

SuperPathways for DHRS1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for DHRS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0055114 oxidation-reduction process IEA --
genes like me logo Genes that share ontologies with DHRS1: view

No data available for Pathways by source and SIGNOR curated interactions for DHRS1 Gene

Drugs & Compounds for DHRS1 Gene

No Compound Related Data Available

Transcripts for DHRS1 Gene

mRNA/cDNA for DHRS1 Gene

Unigene Clusters for DHRS1 Gene

Dehydrogenase/reductase (SDR family) member 1:
Representative Sequences:

Clone Products

  • Addgene plasmids for DHRS1

Alternative Splicing Database (ASD) splice patterns (SP) for DHRS1 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b ^ 4a · 4b ^ 5 ^ 6a · 6b · 6c · 6d · 6e · 6f ^ 7 ^ 8a · 8b ^ 9 ^ 10a · 10b
SP1: - - - - - - - -
SP2: - - - - - - -
SP3: - - - -
SP4: - - - - -
SP5: -
SP6: - - - -
SP7: - -
SP9: -

Relevant External Links for DHRS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for DHRS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for DHRS1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for DHRS1 Gene

This gene is overexpressed in Esophagus - Mucosa (x4.7) and Liver (x4.4).

Protein differential expression in normal tissues from HIPED for DHRS1 Gene

This gene is overexpressed in Liver (8.4), Nasopharynx (7.7), and Milk (7.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for DHRS1 Gene

Protein tissue co-expression partners for DHRS1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of DHRS1 Gene:


SOURCE GeneReport for Unigene cluster for DHRS1 Gene:


mRNA Expression by UniProt/SwissProt for DHRS1 Gene:

Tissue specificity: Detected in heart and liver, and at low levels in skeletal muscle, kidney and pancreas.

Evidence on tissue expression from TISSUES for DHRS1 Gene

  • Nervous system(4.5)
  • Liver(4.4)
  • Skin(4.3)
  • Pancreas(4.1)
genes like me logo Genes that share expression patterns with DHRS1: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for DHRS1 Gene

Orthologs for DHRS1 Gene

This gene was present in the common ancestor of animals.

Orthologs for DHRS1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia DHRS1 34 33
  • 98.72 (n)
(Bos Taurus)
Mammalia DHRS1 34 33
  • 85.58 (n)
(Canis familiaris)
Mammalia DHRS1 34 33
  • 85.41 (n)
(Rattus norvegicus)
Mammalia Dhrs1 33
  • 84.35 (n)
(Mus musculus)
Mammalia Dhrs1 16 34 33
  • 84.13 (n)
(Monodelphis domestica)
Mammalia DHRS1 34
  • 76 (a)
(Ornithorhynchus anatinus)
Mammalia DHRS1 34
  • 71 (a)
(Anolis carolinensis)
Reptilia DHRS1 34
  • 57 (a)
(Danio rerio)
Actinopterygii dhrs1 34 33
  • 58.52 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.316 33
(Caenorhabditis elegans)
Secernentea dhs-9 34 33
  • 52.32 (n)
F59E11.2 34
  • 42 (a)
dhs-26 34
  • 40 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 52 (a)
-- 34
  • 43 (a)
Species where no ortholog for DHRS1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for DHRS1 Gene

Gene Tree for DHRS1 (if available)
Gene Tree for DHRS1 (if available)
Evolutionary constrained regions (ECRs) for DHRS1: view image

Paralogs for DHRS1 Gene

Paralogs for DHRS1 Gene

genes like me logo Genes that share paralogs with DHRS1: view

Variants for DHRS1 Gene

Sequence variations from dbSNP and Humsavar for DHRS1 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs1000065403 -- 24,290,707(-) CACCCCAGAACTCACC/CACCCCAGAACTCACCCCAGAACTCACC 3_prime_UTR_variant
rs1000147165 -- 24,297,185(-) G/A intron_variant
rs1000203991 -- 24,299,737(-) T/G 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant
rs1000752062 -- 24,291,312(-) C/T intron_variant
rs1000827936 -- 24,299,871(-) C/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for DHRS1 Gene

Variant ID Type Subtype PubMed ID
esv2669637 CNV deletion 23128226
esv3633804 CNV loss 21293372

Variation tolerance for DHRS1 Gene

Residual Variation Intolerance Score: 32.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.36; 70.92% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for DHRS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DHRS1 Gene

Disorders for DHRS1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for DHRS1 Gene - From: GeneCards

Disorder Aliases PubMed IDs
specific language impairment
- elite association - COSMIC cancer census association via MalaCards
Search DHRS1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for DHRS1

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with DHRS1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for DHRS1 Gene

Publications for DHRS1 Gene

  1. Molecular cloning and characterization of a novel Dehydrogenase/reductase (SDR family) member 1 genea from human fetal brain. (PMID: 12153138) Wu Q … Mao Y (Molecular biology reports 2001) 2 3 4 22 58
  2. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 44 58
  3. The SDR (short-chain dehydrogenase/reductase and related enzymes) nomenclature initiative. (PMID: 19027726) Persson B … Oppermann U (Chemico-biological interactions 2009) 2 3 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58

Products for DHRS1 Gene

  • Addgene plasmids for DHRS1

Sources for DHRS1 Gene

Loading form....