Aliases for DDIT4L Gene
Aliases for DDIT4L Gene
External Ids for DDIT4L Gene
- HGNC: 30555
- Entrez Gene: 115265
- Ensembl: ENSG00000145358
- OMIM: 607730
- UniProtKB: Q96D03
Previous GeneCards Identifiers for DDIT4L Gene
- GC00U914340
- GC04M101567
- GC04M101464
- GC04M101326
- GC04M101107
- GC04M096845
Summaries for DDIT4L Gene
GeneCards Summary for DDIT4L Gene
DDIT4L (DNA Damage Inducible Transcript 4 Like) is a Protein Coding gene. Among its related pathways are mTOR signalling. An important paralog of this gene is DDIT4.
UniProtKB/Swiss-Prot for DDIT4L Gene
-
Inhibits cell growth by regulating the TOR signaling pathway upstream of the TSC1-TSC2 complex and downstream of AKT1.
Additional gene information for DDIT4L Gene
No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DDIT4L Gene
Genomics for DDIT4L Gene
GeneHancer (GH) Regulatory Elements for DDIT4L Gene
Promoters and enhancers for DDIT4L Gene
| GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
|---|---|---|---|---|---|---|---|---|---|---|
| GH04I100189 | Promoter/Enhancer | 1.5 | EPDnew Ensembl ENCODE | 550.8 | +0.7 | 681 | 1.4 | ZNF335 GLIS2 POLR2A GLIS1 SCRT2 NFE2 EZH2 | DDIT4L LOC101929353 DNAJB14 LOC256880 | |
| GH04I100191 | Enhancer | 0.4 | ENCODE | 550.8 | -0.1 | -97 | 0.2 | NFE2 EZH2 | LOC101929353 DDIT4L PIR53160 GC04P100245 LOC256880 | |
| GH04I100190 | Enhancer | 0.4 | Ensembl | 550.8 | +1.7 | 1681 | 0.2 | GLIS1 EZH2 | DDIT4L LOC101929353 DYNLL1P6 LOC256880 | |
| GH04I100192 | Enhancer | 0.3 | ENCODE | 554.9 | -0.8 | -836 | 1 | EZH2 | DDIT4L LOC101929353 PIR53160 GC04P100245 LOC256880 | |
| GH04I100288 | Enhancer | 0.7 | Ensembl ENCODE | 6.5 | -99.0 | -98969 | 3 | JUND JUN CEBPB FOS ATF2 | DDIT4L PIR53160 GC04P100245 GC04M100396 |
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around DDIT4L on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the DDIT4L gene promoter:
Regulatory Element Products
Genomic Locations for DDIT4L Gene
Genomic Locations for DDIT4L Gene
- chr4:100,185,110-100,190,782
- (GRCh38/hg38)
- Size:
- 5,673 bases
- Orientation:
- Minus strand
- chr4:101,107,027-101,111,939
- (GRCh37/hg19)
Genomic View for DDIT4L Gene
Genes around DDIT4L on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 4q24 by Ensembl
- 4q24 by Entrez Gene
- 4q24 by HGNC
DDIT4L Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for DDIT4L Gene
Proteins for DDIT4L Gene
-
Protein details for DDIT4L Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q96D03-DDT4L_HUMAN
- Recommended name:
- DNA damage-inducible transcript 4-like protein
- Protein Accession:
- Q96D03
- B2R7C3
Protein attributes for DDIT4L Gene
- Size:
- 193 amino acids
- Molecular mass:
- 21740 Da
- Quaternary structure:
- No Data Available
Protein Expression for DDIT4L Gene
Post-translational modifications for DDIT4L Gene
Other Protein References for DDIT4L Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for DDIT4L
- Novus Biologicals Antibodies for DDIT4L
-
Abcam antibodies for DDIT4L
- Invitrogen Antibodies for DDIT4L
- GeneTex DDIT4L antibody for DDIT4L
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for DDIT4L
- Origene Custom Protein Services for DDIT4L
- antibodies-online: Search results for 8 available DDIT4L Proteins ranked by validation data
- Compare Top DDIT4L Proteins
-
Quality Products:
- Search GeneTex for Proteins for DDIT4L
-
Abcam proteins for DDIT4L
Assay Products
- antibodies-online: Search results for 3 available DDIT4L Elisa Kits ranked by validation data
- Compare Top DDIT4L Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for DDIT4L Gene
Domains & Families for DDIT4L Gene
Gene Families for DDIT4L Gene
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
Protein Domains for DDIT4L Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for DDIT4L Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q96D03- Family:
-
- Belongs to the DDIT4 family.
Function for DDIT4L Gene
Molecular function for DDIT4L Gene
- UniProtKB/Swiss-Prot Function:
- Inhibits cell growth by regulating the TOR signaling pathway upstream of the TSC1-TSC2 complex and downstream of AKT1.
- UniProtKB/Swiss-Prot Induction:
- Up-regulated by oxidized LDL and hypoxia in macrophages.
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005515 | protein binding | IPI | 16189514 |
Phenotypes for DDIT4L Gene
- GenomeRNAi human phenotypes for DDIT4L:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for DDIT4L
-
-
ViGene Biosciences lentiviral particle packaged cDNA for DDIT4L gene
-
ViGene Biosciences ready-to-package AAV shRNAs for DDIT4L gene
- Search ViGene Biosciences for DDIT4L
CRISPR Products
-
OriGene CRISPR knockouts for DDIT4L
- genomics-online: gRNA clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
- Applied Biological Materials CRISPR for DDIT4L
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for DDIT4L
- GenScript: Design CRISPR guide RNA sequences for DDIT4L
miRNA for DDIT4L Gene
- miRTarBase miRNAs that target DDIT4L
miRNA Products
- Search ViGene Biosciences for DDIT4L
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for DDIT4L
- Browse OriGene Inhibitory RNA Products For DDIT4L
- genomics-online: shRNA clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for DDIT4L gene
Clone Products
- Sino Biological Human cDNA Clone for DDIT4L
- VectorBuilder custom plasmid, inducible vectors for DDIT4L
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for DDIT4L
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for DDIT4L
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for DDIT4L
-
ViGene Biosciences adenoviral particle packaged cDNA for DDIT4L gene
-
ViGene Biosciences lentiviral particle packaged cDNA for DDIT4L gene
-
ViGene Biosciences ready-to-package AAV shRNAs for DDIT4L gene
No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for DDIT4L Gene
Localization for DDIT4L Gene
Subcellular locations from UniProtKB/Swiss-Prot for DDIT4L Gene
- Cytoplasm.
| Compartment | Confidence |
|---|---|
| nucleus | 2 |
| cytosol | 2 |
| extracellular | 1 |
- Actin filaments (1)
- Nucleoplasm (1)
- Plasma membrane (1)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005737 | cytoplasm | ISS,IEA | -- |
Pathways & Interactions for DDIT4L Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | mTOR signalling | ||
Pathways by source for DDIT4L Gene
1 GeneTex pathway for DDIT4L Gene
1 BioSystems pathway for DDIT4L Gene
Interacting Proteins for DDIT4L Gene
Selected Interacting proteins:
Q96D03-DDT4L_HUMAN
ENSP00000354830
for DDIT4L Gene via
UniProtKB
IID
STRING
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0009968 | negative regulation of signal transduction | IEA | -- |
No data available for SIGNOR curated interactions for DDIT4L Gene
Transcripts for DDIT4L Gene
mRNA/cDNA for DDIT4L Gene
- (1) REFSEQ mRNAs :
- (4) Additional mRNA sequences :
- (69) Selected AceView cDNA sequences:
- (3) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for DDIT4L Gene
CRISPR Products
-
OriGene CRISPR knockouts for DDIT4L
- genomics-online: gRNA clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
- Applied Biological Materials CRISPR for DDIT4L
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for DDIT4L
- GenScript: Design CRISPR guide RNA sequences for DDIT4L
miRNA Products
- Search ViGene Biosciences for DDIT4L
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for DDIT4L
- Browse OriGene Inhibitory RNA Products For DDIT4L
- genomics-online: shRNA clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for DDIT4L gene
Clone Products
- Sino Biological Human cDNA Clone for DDIT4L
- VectorBuilder custom plasmid, inducible vectors for DDIT4L
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for DDIT4L
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for DDIT4L
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for DDIT4L Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Brain (Nervous System)
- Bone (Muscoskeletal System)
- Gut Tube (Gastrointestinal Tract)
- Neural Tube (Nervous System)
- Mesoderm (Gastrulation Derivatives)
- Neural Crest (Gastrulation Derivatives)
-
Skeletal Muscle (Muscoskeletal System)
mRNA differential expression in normal tissues according to GTEx for DDIT4L Gene
This gene is overexpressed in Muscle - Skeletal (x33.1).
This gene is overexpressed in Kidney (40.6), Heart (22.3), and Bone marrow mesenchymal stem cell (6.1).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for DDIT4L Gene
NURSA nuclear receptor signaling pathways regulating expression of DDIT4L Gene:
DDIT4LSOURCE GeneReport for Unigene cluster for DDIT4L Gene:
Hs.480378mRNA Expression by UniProt/SwissProt for DDIT4L Gene:
Q96D03-DDT4L_HUMAN
Tissue specificity:
Up-regulated in atherosclerotic plaques relative to healthy segments of the same artery.
Evidence on tissue expression from TISSUES for DDIT4L Gene
- Nervous system(4.3)
- Lung(4)
- Lymph node(4)
- Muscle(3)
Primer Products
-
OriGene qPCR primer pairs and template standards for DDIT4L
-
OriGene qPCR primer pairs for DDIT4L
- genomics-online: primer clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
Gene Expression Assay Products
No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for DDIT4L Gene
Orthologs for DDIT4L Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | DDIT4L 33 34 |
|
||
| dog (Canis familiaris) |
Mammalia | DDIT4L 33 34 |
|
||
| cow (Bos Taurus) |
Mammalia | DDIT4L 33 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Ddit4l 33 16 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | LOC100363484 33 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | DDIT4L 34 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | DDIT4L 34 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | DDIT4L 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | ddit4l 33 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | chrb 34 |
|
ManyToMany | |
| scyl 34 |
|
ManyToMany |
- Species where no ortholog for DDIT4L was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chicken (Gallus gallus)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
- zebrafish (Danio rerio)
Paralogs for DDIT4L Gene
(1) SIMAP similar genes for DDIT4L Gene using alignment to 3 proteins:
Variants for DDIT4L Gene
| SNP ID | Clin | Chr 04 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1000058552 | -- | 100,190,533(-) | GCACCGCCCCTCCCCGGCCAGCGC/GC | upstream_transcript_variant | |
| rs1000395053 | -- | 100,191,433(-) | G/T | upstream_transcript_variant | |
| rs10007201 | -- | 100,187,175(-) | C/T | 3_prime_UTR_variant | |
| rs1001404871 | -- | 100,185,509(-) | T/G | downstream_transcript_variant | |
| rs1001431061 | -- | 100,190,513(-) | C/G | upstream_transcript_variant |
Residual Variation Intolerance Score:
62.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
5.94;
74.54% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for DDIT4L Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- DDIT4L
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DDIT4L Gene
Disorders for DDIT4L Gene
Additional Disease Information for DDIT4L
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No disorders were found for DDIT4L Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for DDIT4L Gene
Publications for DDIT4L Gene
- The stress-inducted proteins RTP801 and RTP801L are negative regulators of the mammalian target of rapamycin pathway. (PMID: 15632201) Corradetti MN … Guan KL (The Journal of biological chemistry 2005) 3 4 22 58
- REDD2 gene is upregulated by modified LDL or hypoxia and mediates human macrophage cell death. (PMID: 15308555) Cuaz-Pérolin C … Rouis M (Arteriosclerosis, thrombosis, and vascular biology 2004) 3 4 22 58
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
- Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 58
- REDD1, a developmentally regulated transcriptional target of p63 and p53, links p63 to regulation of reactive oxygen species. (PMID: 12453409) Ellisen LW … Haber DA (Molecular cell 2002) 3 4 58
Products for DDIT4L Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for DDIT4L
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for DDIT4L
- Origene Custom Protein Services for DDIT4L
- Origene shrna, sirna, and RNAi products in human, mouse, rat for DDIT4L
- Browse OriGene Inhibitory RNA Products For DDIT4L
- OriGene qPCR primer pairs and template standards for DDIT4L
- OriGene qPCR primer pairs for DDIT4L
- OriGene CRISPR knockouts for DDIT4L
- OriGene ORF clones in human for DDIT4L
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For DDIT4L
- GenScript: Next-day shipping of latest version cDNA ORF clones for DDIT4L in any vector
- GenScript Custom Purified and Recombinant Proteins Services for DDIT4L
- GenScript Custom Assay Services for DDIT4L
- GenScript Custom overexpressing Cell Line Services for DDIT4L
- GenScript: Design CRISPR guide RNA sequences for DDIT4L
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for DDIT4L
- Sino Biological Human cDNA Clone for DDIT4L
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for DDIT4L
- Novus Biologicals lysates and proteins for DDIT4L
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for DDIT4L
- Abcam proteins for DDIT4L
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Cyagen custom Knockout/knockin (KOKI) mouse models for DDIT4L
- VectorBuilder custom plasmid, inducible vectors for DDIT4L
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for DDIT4L
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 63 available DDIT4L Antibodies ranked by validation data
- Compare Top DDIT4L Antibodies
- antibodies-online: Search results for 3 available DDIT4L Elisa Kits ranked by validation data
- Compare Top DDIT4L Elisa Kits
- Quality Products:
- antibodies-online: Search results for 8 available DDIT4L Proteins ranked by validation data
- Compare Top DDIT4L Proteins
- Quality Products:
- GeneTex DDIT4L antibody for DDIT4L
- Search GeneTex for Proteins for DDIT4L
- ViGene Biosciences adenoviral particle packaged cDNA for DDIT4L gene
- ViGene Biosciences lentiviral particle packaged cDNA for DDIT4L gene
- ViGene Biosciences ready-to-package AAV shRNAs for DDIT4L gene
- Search ViGene Biosciences for DDIT4L
- Horizon Cell Lines for DDIT4L
- genomics-online: cdna clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
- orf clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
- genomics-online: gRNA clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
- genomics-online: primer clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
- genomics-online: shRNA clones - Search results for 101 available DDIT4L gene related products
- Overview of 101 available DDIT4L gene related products
Sources for DDIT4L Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
