The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in... See more...

Aliases for DBN1 Gene

Aliases for DBN1 Gene

  • Drebrin 1 2 3 5
  • Developmentally-Regulated Brain Protein 3 4
  • Drebrin 3 4
  • D0S117E 3 4
  • Drebrin E2 3
  • Drebrin A 3
  • Drebrin E 3

External Ids for DBN1 Gene

Previous HGNC Symbols for DBN1 Gene

  • D0S117E

Previous GeneCards Identifiers for DBN1 Gene

  • GC05M177180
  • GC05M177726
  • GC05M176819
  • GC05M176865
  • GC05M176867
  • GC05M176816
  • GC05M176883
  • GC05M171803

Summaries for DBN1 Gene

Entrez Gene Summary for DBN1 Gene

  • The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for DBN1 Gene

DBN1 (Drebrin 1) is a Protein Coding gene. Diseases associated with DBN1 include Alzheimer Disease and Glaucomatocyclitic Crisis. Among its related pathways are Cytoskeletal Signaling and Neuroscience. Gene Ontology (GO) annotations related to this gene include actin binding and profilin binding. An important paralog of this gene is DBNL.

UniProtKB/Swiss-Prot Summary for DBN1 Gene

  • Actin cytoskeleton-organizing protein that plays a role in the formation of cell projections (PubMed:20215400). Required for actin polymerization at immunological synapses (IS) and for the recruitment of the chemokine receptor CXCR4 to IS (PubMed:20215400). Plays a role in dendritic spine morphogenesis and organization, including the localization of the dopamine receptor DRD1 to the dendritic spines (By similarity). Involved in memory-related synaptic plasticity in the hippocampus (By similarity).

Gene Wiki entry for DBN1 Gene

Additional gene information for DBN1 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for DBN1 Gene

Genomics for DBN1 Gene

GeneHancer (GH) Regulatory Elements for DBN1 Gene

Promoters and enhancers for DBN1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around DBN1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the DBN1 gene promoter:
  • E47
  • Egr-4
  • GCNF
  • GCNF-1
  • GCNF-2

Genomic Locations for DBN1 Gene

Genomic Locations for DBN1 Gene
chr5:177,456,608-177,480,336
(GRCh38/hg38)
Size:
23,729 bases
Orientation:
Minus strand
chr5:176,883,609-176,901,402
(GRCh37/hg19)
Size:
17,794 bases
Orientation:
Minus strand

Genomic View for DBN1 Gene

Genes around DBN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DBN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DBN1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DBN1 Gene

Proteins for DBN1 Gene

  • Protein details for DBN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q16643-DREB_HUMAN
    Recommended name:
    Drebrin
    Protein Accession:
    Q16643
    Secondary Accessions:
    • A8MV58
    • B2RBG0
    • Q9UFZ5

    Protein attributes for DBN1 Gene

    Size:
    649 amino acids
    Molecular mass:
    71429 Da
    Quaternary structure:
    • Interacts with RUFY3 (By similarity). Interacts with CXCR4; this interaction is enhanced by antigenic stimulation (PubMed:20215400). Interacts (via ADF-H domain) with ZMYND8 (via PHD-type Zinc finger, Bromo and PWWP domains); the interaction leads to sequestering of ZMYND8 in the cytoplasm (PubMed:28966017).

    Three dimensional structures from OCA and Proteopedia for DBN1 Gene

    Alternative splice isoforms for DBN1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for DBN1 Gene

Post-translational modifications for DBN1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Antibody Products

No data available for DME Specific Peptides for DBN1 Gene

Domains & Families for DBN1 Gene

Gene Families for DBN1 Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for DBN1 Gene

Suggested Antigen Peptide Sequences for DBN1 Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ36806 fis, clone ASTRO1000165, highly similar to Drebrin (B3KSQ7_HUMAN)
  • Developmentally-regulated brain protein (DREB_HUMAN)
genes like me logo Genes that share domains with DBN1: view

No data available for Graphical View of Domain Structure and UniProtKB/Swiss-Prot for DBN1 Gene

Function for DBN1 Gene

Molecular function for DBN1 Gene

UniProtKB/Swiss-Prot Function:
Actin cytoskeleton-organizing protein that plays a role in the formation of cell projections (PubMed:20215400). Required for actin polymerization at immunological synapses (IS) and for the recruitment of the chemokine receptor CXCR4 to IS (PubMed:20215400). Plays a role in dendritic spine morphogenesis and organization, including the localization of the dopamine receptor DRD1 to the dendritic spines (By similarity). Involved in memory-related synaptic plasticity in the hippocampus (By similarity).
GENATLAS Biochemistry:
drebrin,actin binding protein involved in neuronal growth,developmentally regulated,embryonic isoforms E1,E2

Phenotypes From GWAS Catalog for DBN1 Gene

Gene Ontology (GO) - Molecular Function for DBN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003779 actin binding NAS 12761245
GO:0005515 protein binding IPI 12577067
GO:0005522 profilin binding ISS --
GO:0045296 cadherin binding HDA 25468996
GO:0051015 actin filament binding IBA 21873635
genes like me logo Genes that share ontologies with DBN1: view
genes like me logo Genes that share phenotypes with DBN1: view

Animal Models for DBN1 Gene

MGI Knock Outs for DBN1:
  • Dbn1 Dbn1<tm1b(KOMP)Wtsi>
  • Dbn1 Dbn1<tm1a(KOMP)Wtsi>
  • Dbn1 Dbn1<tm1.1Lbc>
  • Dbn1 Dbn1<tm1.1Shira>

Animal Model Products

CRISPR Products

miRNA for DBN1 Gene

miRTarBase miRNAs that target DBN1

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for DBN1

Clone Products

  • Addgene plasmids for DBN1

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for DBN1 Gene

Localization for DBN1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for DBN1 Gene

Cytoplasm. Cell projection, dendrite. Cytoplasm, cell cortex. Cell junction. Cell projection, growth cone. Note=In the absence of antigen, evenly distributed throughout subcortical regions of the T-cell membrane and cytoplasm (PubMed:20215400). In the presence of antigen, distributes to the immunological synapse forming at the T-cell-APC contact area, where it localizes at the peripheral and distal supramolecular activation clusters (SMAC) (PubMed:20215400). Colocalized with RUFY3 and F-actin at the transitional domain of the axonal growth cone (By similarity). {ECO:0000250 UniProtKB:Q9QXS6, ECO:0000269 PubMed:20215400}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DBN1 gene
Compartment Confidence
cytoskeleton 5
plasma membrane 4
cytosol 3
nucleus 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Actin filaments (3)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for DBN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
GO:0005737 cytoplasm NAS 12009525
GO:0005856 cytoskeleton IDA 24327345
GO:0005884 colocalizes_with actin filament IBA 21873635
GO:0005886 plasma membrane IEA,IBA 21873635
genes like me logo Genes that share ontologies with DBN1: view

Pathways & Interactions for DBN1 Gene

PathCards logo

SuperPathways for DBN1 Gene

SuperPathway Contained pathways
1 Cytoskeletal Signaling
2 Neuroscience
3 G-Beta Gamma Signaling
.30
genes like me logo Genes that share pathways with DBN1: view

Pathways by source for DBN1 Gene

1 Qiagen pathway for DBN1 Gene
  • Signaling in Gap Junctions
2 Cell Signaling Technology pathways for DBN1 Gene

Gene Ontology (GO) - Biological Process for DBN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001701 in utero embryonic development IEA --
GO:0007015 actin filament organization IEA,ISS --
GO:0007275 multicellular organism development IEA --
GO:0007399 nervous system development IEA --
GO:0010643 cell communication by chemical coupling IEA --
genes like me logo Genes that share ontologies with DBN1: view

No data available for SIGNOR curated interactions for DBN1 Gene

Drugs & Compounds for DBN1 Gene

(2) Drugs for DBN1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(2) Additional Compounds for DBN1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with DBN1: view

Transcripts for DBN1 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for DBN1

Clone Products

  • Addgene plasmids for DBN1

Alternative Splicing Database (ASD) splice patterns (SP) for DBN1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14 ^ 15a · 15b ^ 16 ^ 17a · 17b · 17c
SP1: - - -
SP2: - - - - -
SP3: - - - - -
SP4: -
SP5:
SP6: - -

Relevant External Links for DBN1 Gene

GeneLoc Exon Structure for
DBN1
ECgene alternative splicing isoforms for
DBN1

Expression for DBN1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for DBN1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for DBN1 Gene

This gene is overexpressed in Fetal Brain (18.5), Bone marrow mesenchymal stem cell (10.8), and Bone marrow stromal cell (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for DBN1 Gene



Protein tissue co-expression partners for DBN1 Gene

NURSA nuclear receptor signaling pathways regulating expression of DBN1 Gene:

DBN1

SOURCE GeneReport for Unigene cluster for DBN1 Gene:

Hs.130316

mRNA Expression by UniProt/SwissProt for DBN1 Gene:

Q16643-DREB_HUMAN
Tissue specificity: Expressed in the brain, with expression in the molecular layer of the dentate gyrus, stratum pyramidale, and stratum radiatum of the hippocampus (at protein level) (PubMed:8838578). Also expressed in the terminal varicosities distributed along dendritic trees of pyramidal cells in CA4 and CA3 of the hippocampus (at protein level) (PubMed:8838578). Expressed in pyramidal cells in CA2, CA1 and the subiculum of the hippocampus (at protein level) (PubMed:8838578). Expressed in peripheral blood lymphocytes, including T-cells (at protein level) (PubMed:20215400). Expressed in the brain (PubMed:8216329, Ref.2). Expressed in the heart, placenta, lung, skeletal muscle, kidney, pancreas, skin fibroblasts, gingival fibroblasts and bone-derived cells (Ref.2).

Evidence on tissue expression from TISSUES for DBN1 Gene

  • Nervous system(5)
  • Muscle(4.4)
  • Blood(4.2)
  • Eye(4.2)
  • Liver(4.2)
  • Bone(4)
  • Kidney(2.7)
genes like me logo Genes that share expression patterns with DBN1: view

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for DBN1 Gene

Orthologs for DBN1 Gene

This gene was present in the common ancestor of animals.

Orthologs for DBN1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia DBN1 33 32
  • 99.41 (n)
OneToOne
cow
(Bos Taurus)
Mammalia DBN1 33 32
  • 88.94 (n)
OneToOne
dog
(Canis familiaris)
Mammalia DBN1 33 32
  • 88.59 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Dbn1 17 33 32
  • 85.63 (n)
rat
(Rattus norvegicus)
Mammalia Dbn1 32
  • 85.42 (n)
oppossum
(Monodelphis domestica)
Mammalia DBN1 33
  • 62 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 33
  • 17 (a)
ManyToMany
chicken
(Gallus gallus)
Aves DBN1 33 32
  • 70.88 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia DBN1 33
  • 62 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia dbn1 32
  • 63.2 (n)
Str.17297 32
African clawed frog
(Xenopus laevis)
Amphibia Xl.24319 32
zebrafish
(Danio rerio)
Actinopterygii LOC561153 32
  • 64.72 (n)
dbn1 33
  • 49 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG10083 33
  • 19 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea K08E3.4 33
  • 17 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.3471 33
  • 23 (a)
OneToMany
Species where no ortholog for DBN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for DBN1 Gene

ENSEMBL:
Gene Tree for DBN1 (if available)
TreeFam:
Gene Tree for DBN1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for DBN1: view image

Paralogs for DBN1 Gene

Paralogs for DBN1 Gene

(1) SIMAP similar genes for DBN1 Gene using alignment to 7 proteins:

  • DREB_HUMAN
  • B3KSQ7_HUMAN
  • D6R9Q9_HUMAN
  • D6R9W4_HUMAN
  • D6RCR4_HUMAN
  • D6RFI1_HUMAN
  • F8W9Z3_HUMAN
genes like me logo Genes that share paralogs with DBN1: view

Variants for DBN1 Gene

Sequence variations from dbSNP and Humsavar for DBN1 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
VAR_035910 A breast cancer sample p.Glu278Lys
VAR_035911 A breast cancer sample p.Glu640Gln
rs1000212219 -- 177,461,518(-) A/G/T intron_variant
rs1000216234 -- 177,472,009(-) G/A/C genic_upstream_transcript_variant, intron_variant
rs1000306866 -- 177,466,351(-) GGAGATGCTGCTCCCAAGGAGATG/GGAGATG genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for DBN1 Gene

Variant ID Type Subtype PubMed ID
dgv10184n54 CNV loss 21841781
dgv3231n106 CNV deletion 24896259
dgv733n27 CNV loss 19166990
dgv963e201 CNV deletion 23290073
esv1004774 CNV deletion 20482838
esv2731196 CNV deletion 23290073
esv2731198 CNV deletion 23290073
nsv1073511 CNV deletion 25765185
nsv1161311 CNV duplication 26073780
nsv1161313 CNV duplication 26073780
nsv329790 CNV deletion 16902084
nsv471057 CNV loss 18288195
nsv515805 CNV loss 19592680

Variation tolerance for DBN1 Gene

Residual Variation Intolerance Score: 13.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.69; 73.02% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for DBN1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
DBN1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DBN1 Gene

Disorders for DBN1 Gene

MalaCards: The human disease database

(2) MalaCards diseases for DBN1 Gene - From: DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
alzheimer disease
  • ad
glaucomatocyclitic crisis
  • posner-schlossman syndrome
- elite association - COSMIC cancer census association via MalaCards
Search DBN1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

DREB_HUMAN
  • Alzheimer disease (AD) [MIM:104300]: Alzheimer disease is a neurodegenerative disorder characterized by progressive dementia, loss of cognitive abilities, and deposition of fibrillar amyloid proteins as intraneuronal neurofibrillary tangles, extracellular amyloid plaques and vascular amyloid deposits. The major constituents of these plaques are neurotoxic amyloid-beta protein 40 and amyloid-beta protein 42, that are produced by the proteolysis of the transmembrane APP protein. The cytotoxic C-terminal fragments (CTFs) and the caspase-cleaved products, such as C31, are also implicated in neuronal death. {ECO:0000269 PubMed:8838578}. Note=The protein represented in this entry may be involved in disease pathogenesis. In brains of patients with AD, decreased expression and absence from dystrophic neurites in amyloid plaques. Disappearance of debrin from the hippocampus may contribute to the pathogenesis of memory disturbance in AD. {ECO:0000269 PubMed:8838578}.

Additional Disease Information for DBN1

genes like me logo Genes that share disorders with DBN1: view

No data available for Genatlas for DBN1 Gene

Publications for DBN1 Gene

  1. Molecular cloning of cDNA encoding human drebrin E and chromosomal mapping of its gene. (PMID: 8216329) Toda M … Uyemura K (Biochemical and biophysical research communications 1993) 2 3 4 23 56
  2. F-actin-binding protein drebrin regulates CXCR4 recruitment to the immune synapse. (PMID: 20215400) Pérez-Martínez M … Sánchez-Madrid F (Journal of cell science 2010) 3 4 23 56
  3. Disappearance of actin-binding protein, drebrin, from hippocampal synapses in Alzheimer's disease. (PMID: 8838578) Harigaya Y … Hirai S (Journal of neuroscience research 1996) 3 4 23 56
  4. The Structure of the ZMYND8/Drebrin Complex Suggests a Cytoplasmic Sequestering Mechanism of ZMYND8 by Drebrin. (PMID: 28966017) Yao N … Zhang M (Structure (London, England : 1993) 2017) 3 4 56
  5. Control of cell shape and plasticity during development and disease by the actin-binding protein Drebrin. (PMID: 20183806) Dun XP … Chilton JK (Histology and histopathology 2010) 3 23 56

Products for DBN1 Gene

Sources for DBN1 Gene