This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bil... See more...

Aliases for CYP27A1 Gene

Aliases for CYP27A1 Gene

  • Cytochrome P450 Family 27 Subfamily A Member 1 2 3 5
  • Cytochrome P450, Subfamily XXVIIA (Steroid 27-Hydroxylase, Cerebrotendinous Xanthomatosis), Polypeptide 1 2 3
  • Cytochrome P450, Family 27, Subfamily A, Polypeptide 1 2 3
  • Sterol 26-Hydroxylase, Mitochondrial 3 4
  • Vitamin D(3) 25-Hydroxylase 3 4
  • Cytochrome P-450C27/25 3 4
  • Sterol 27-Hydroxylase 3 4
  • Cytochrome P450 27 3 4
  • CYP27 3 4
  • 5-Beta-Cholestane-3-Alpha, 7-Alpha, 12-Alpha-Triol 26-Hydroxylase 3
  • 5-Beta-Cholestane-3-Alpha, 7-Alpha, 12-Alpha-Triol 27-Hydroxylase 3
  • 5-Beta-Cholestane-3-Alpha,7-Alpha,12-Alpha-Triol 26-Hydroxylase 4
  • Cholestanetriol 26-Monooxygenase 3
  • Cerebrotendinous Xanthomatosis 2
  • EC 1.14.15.15 4
  • CP27 3
  • CTX 3

External Ids for CYP27A1 Gene

Previous HGNC Symbols for CYP27A1 Gene

  • CYP27

Previous GeneCards Identifiers for CYP27A1 Gene

  • GC02P217662
  • GC02P218367
  • GC02P219610
  • GC02P219849
  • GC02P219472
  • GC02P219354
  • GC02P211499
  • GC02P219646

Summaries for CYP27A1 Gene

Entrez Gene Summary for CYP27A1 Gene

  • This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]

GeneCards Summary for CYP27A1 Gene

CYP27A1 (Cytochrome P450 Family 27 Subfamily A Member 1) is a Protein Coding gene. Diseases associated with CYP27A1 include Cerebrotendinous Xanthomatosis and Xanthomatosis. Among its related pathways are Synthesis of bile acids and bile salts and Cytochrome P450 - arranged by substrate type. Gene Ontology (GO) annotations related to this gene include iron ion binding and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen. An important paralog of this gene is CYP27B1.

UniProtKB/Swiss-Prot Summary for CYP27A1 Gene

  • Cytochrome P450 monooxygenase that catalyzes regio- and stereospecific hydroxylation of cholesterol and its derivatives. Hydroxylates (with R stereochemistry) the terminal methyl group of cholesterol side-chain in a three step reaction to yield at first a C26 alcohol, then a C26 aldehyde and finally a C26 acid (PubMed:9660774, PubMed:12077124, PubMed:21411718, PubMed:28190002). Regulates cholesterol homeostasis by catalyzing the conversion of excess cholesterol to bile acids via both the "neutral" (classic) and the "acid" (alternative) pathways (PubMed:9660774, PubMed:1708392, PubMed:11412116, PubMed:2019602, PubMed:7915755, PubMed:9186905, PubMed:9790667). May also regulate cholesterol homeostasis via generation of active oxysterols, which act as ligands for NR1H2 and NR1H3 nuclear receptors, modulating the transcription of genes involved in lipid metabolism (PubMed:9660774, PubMed:12077124). Plays a role in cholestanol metabolism in the cerebellum. Similarly to cholesterol, hydroxylates cholestanol and may facilitate sterol diffusion through the blood-brain barrier to the systemic circulation for further degradation (PubMed:28190002). Also hydroxylates retinal 7-ketocholesterol, a noxious oxysterol with pro-inflammatory and pro-apoptotic effects, and may play a role in its elimination from the retinal pigment epithelium (PubMed:21411718). May play a redundant role in vitamin D biosynthesis. Catalyzes 25-hydroxylation of vitamin D3 that is required for its conversion to a functionally active form (PubMed:15465040).

Gene Wiki entry for CYP27A1 Gene

Additional gene information for CYP27A1 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for CYP27A1 Gene

Genomics for CYP27A1 Gene

GeneHancer (GH) Regulatory Elements for CYP27A1 Gene

Promoters and enhancers for CYP27A1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02J218781 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas 777.6 +1.9 1852 6 MLX RBPJ TCF7L2 NR2F1 NR2F6 MIXL1 NFYC MNT RERE ELF3 CYP27A1 PLCD4 TTLL4 PRKAG3 PNKD SLC11A1 RNF25 TMBIM1 FJ601684-264 NONHSAG030538.2-002
GH02J218780 Enhancer 0.3 ENCODE 750.6 -1.5 -1513 0.1 FOXA2 CYP27A1 lnc-TTLL4-3 NONHSAG030538.2-002
GH02J218730 Promoter/Enhancer 1.8 FANTOM5 Ensembl ENCODE dbSUPER 19.8 -49.0 -48963 4.4 FOXA1 MLX RBPJ SMARCE1 NR2F1 NR2F6 ATF1 MIXL1 MYC NFYC SLC11A1 RNF25 BCS1L CNOT9 CYP27A1 PLCD4 NHEJ1 STK11IP ANKZF1 SLC23A3
GH02J218393 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 11.1 -380.7 -380742 14.4 PPP1R10 ZNF24 ZBTB40 SP1 CTCF FOXA1 ZBTB6 MLX SMARCE1 RBPJ CTDSP1 AJ421748 ENSG00000273361 HSALNG0022261 MIR26B CNOT9 AAMP USP37 NHEJ1 STK36
GH02J218743 Enhancer 1.3 Ensembl ENCODE dbSUPER 20 -35.3 -35348 10 MLX RBPJ NR2F6 CREB1 MIXL1 CC2D1A RELA HLF L3MBTL2 MAX lnc-RNF25-3 CYP27A1 PLCD4 TTLL4 PRKAG3 WNT6 RNF25 STK36 LINC00608 FEV
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CYP27A1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CYP27A1 gene promoter:
  • COUP
  • COUP-TF
  • COUP-TF1
  • GATA-1
  • HNF-4alpha1
  • HNF-4alpha2
  • NF-kappaB
  • NF-kappaB1
  • p53

Genomic Locations for CYP27A1 Gene

Genomic Locations for CYP27A1 Gene
chr2:218,781,749-218,815,293
(GRCh38/hg38)
Size:
33,545 bases
Orientation:
Plus strand
chr2:219,646,472-219,680,016
(GRCh37/hg19)
Size:
33,545 bases
Orientation:
Plus strand

Genomic View for CYP27A1 Gene

Genes around CYP27A1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CYP27A1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CYP27A1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CYP27A1 Gene

Proteins for CYP27A1 Gene

  • Protein details for CYP27A1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q02318-CP27A_HUMAN
    Recommended name:
    Sterol 26-hydroxylase, mitochondrial
    Protein Accession:
    Q02318
    Secondary Accessions:
    • A8K303
    • Q6LDB4
    • Q86YQ6

    Protein attributes for CYP27A1 Gene

    Size:
    531 amino acids
    Molecular mass:
    60235 Da
    Cofactor:
    Name=heme; Xref=ChEBI:CHEBI:30413;
    Quaternary structure:
    • Interacts with HSP70; this interaction is required for initial targeting to mitochondria.

    Three dimensional structures from OCA and Proteopedia for CYP27A1 Gene

neXtProt entry for CYP27A1 Gene

Post-translational modifications for CYP27A1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CYP27A1 Gene

No data available for DME Specific Peptides for CYP27A1 Gene

Domains & Families for CYP27A1 Gene

Gene Families for CYP27A1 Gene

HGNC:
IUPHAR :
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for CYP27A1 Gene

GenScript: Design optimal peptide antigens:
  • Vitamin D(3) 25-hydroxylase (CP27A_HUMAN)
  • Sterol 27-hydroxylase (Q96T86_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q02318

UniProtKB/Swiss-Prot:

CP27A_HUMAN :
  • Belongs to the cytochrome P450 family.
Family:
  • Belongs to the cytochrome P450 family.
genes like me logo Genes that share domains with CYP27A1: view

Function for CYP27A1 Gene

Molecular function for CYP27A1 Gene

UniProtKB/Swiss-Prot Function:
Cytochrome P450 monooxygenase that catalyzes regio- and stereospecific hydroxylation of cholesterol and its derivatives. Hydroxylates (with R stereochemistry) the terminal methyl group of cholesterol side-chain in a three step reaction to yield at first a C26 alcohol, then a C26 aldehyde and finally a C26 acid (PubMed:9660774, PubMed:12077124, PubMed:21411718, PubMed:28190002). Regulates cholesterol homeostasis by catalyzing the conversion of excess cholesterol to bile acids via both the "neutral" (classic) and the "acid" (alternative) pathways (PubMed:9660774, PubMed:1708392, PubMed:11412116, PubMed:2019602, PubMed:7915755, PubMed:9186905, PubMed:9790667). May also regulate cholesterol homeostasis via generation of active oxysterols, which act as ligands for NR1H2 and NR1H3 nuclear receptors, modulating the transcription of genes involved in lipid metabolism (PubMed:9660774, PubMed:12077124). Plays a role in cholestanol metabolism in the cerebellum. Similarly to cholesterol, hydroxylates cholestanol and may facilitate sterol diffusion through the blood-brain barrier to the systemic circulation for further degradation (PubMed:28190002). Also hydroxylates retinal 7-ketocholesterol, a noxious oxysterol with pro-inflammatory and pro-apoptotic effects, and may play a role in its elimination from the retinal pigment epithelium (PubMed:21411718). May play a redundant role in vitamin D biosynthesis. Catalyzes 25-hydroxylation of vitamin D3 that is required for its conversion to a functionally active form (PubMed:15465040).
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=5beta-cholestane-3alpha,7alpha,12alpha-triol + 5 H(+) + 3 O2 + 6 reduced [adrenodoxin] = (25R)-3alpha,7alpha,12alpha-trihydroxy-5beta-cholestan-26-oate + 4 H2O + 6 oxidized [adrenodoxin]; Xref=Rhea:RHEA:34631, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:16496, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:58734; EC=1.14.15.15; Evidence={ECO:0000269 PubMed:11412116, ECO:0000269 PubMed:1708392, ECO:0000269 PubMed:2019602, ECO:0000269 PubMed:9186905, ECO:0000269 PubMed:9790667}; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:34632; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=cholestanol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-26-hydroxycholestanol + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:53812, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:86570, ChEBI:CHEBI:137688; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:53813; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-3beta-hydroxycholest-5-en-7-one-26-al + H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3beta-hydroxycholest-5-en-7-one-26-oate + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:47380, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:87677, ChEBI:CHEBI:87678; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:47381; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-3beta,26-dihydroxycholest-5-en-7-one + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3beta-hydroxycholest-5-en-7-one-26-al + 2 H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:47376, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:87653, ChEBI:CHEBI:87677; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:47377; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=3beta-hydroxycholest-5-en-7-one + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3beta,26-dihydroxycholest-5-en-7-one + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:47344, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:64294, ChEBI:CHEBI:87653; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:47345; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=calciol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = calcidiol + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:46588, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:17933, ChEBI:CHEBI:28940, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:46589; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-5beta-cholestane-3alpha,7alpha,12alpha,26-tetrol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3alpha,7alpha,12alpha-trihydroxy-5beta-cholestan-26-al + 2 H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:40231, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:48939, ChEBI:CHEBI:48940; Evidence={ECO:0000269 PubMed:11412116, ECO:0000269 PubMed:1708392}; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:40232; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=cholesterol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-cholest-5-ene-3beta,26-diol + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:46400, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:16113, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:76591; Evidence={ECO:0000269 PubMed:12077124, ECO:0000269 PubMed:21411718, ECO:0000269 PubMed:9660774}; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:46401; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-3beta,4beta-dihydroxycholest-5-en-26-al + H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3beta,4beta-dihydroxycholest-5-en-26-oate + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:46436, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:86115, ChEBI:CHEBI:86116; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:46437; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-4beta,26-dihydroxycholesterol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3beta,4beta-dihydroxycholest-5-en-26-al + 2 H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:46432, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:86113, ChEBI:CHEBI:86115; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:46433; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=4beta-hydroxycholesterol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-4beta,26-dihydroxycholesterol + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:46428, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:85778, ChEBI:CHEBI:86113; Evidence=. ; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:46429; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-3beta-hydroxy-5-cholesten-26-al + H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3beta-hydroxy-5-cholestenoate + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:45236, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:86096, ChEBI:CHEBI:86098; Evidence={ECO:0000269 PubMed:12077124, ECO:0000269 PubMed:9660774}; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:45237; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-cholest-5-ene-3beta,26-diol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3beta-hydroxy-5-cholesten-26-al + 2 H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:46092, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:76591, ChEBI:CHEBI:86096; Evidence={ECO:0000269 PubMed:12077124, ECO:0000269 PubMed:9660774}; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:46093; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=(25R)-3alpha,7alpha,12alpha-trihydroxy-5beta-cholestan-26-al + H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-3alpha,7alpha,12alpha-trihydroxy-5beta-cholestan-26-oate + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:34627, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:48940, ChEBI:CHEBI:58734; Evidence={ECO:0000269 PubMed:11412116, ECO:0000269 PubMed:1708392}; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:34628; Evidence=. ;.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=5beta-cholestane-3alpha,7alpha,12alpha-triol + 2 H(+) + O2 + 2 reduced [adrenodoxin] = (25R)-5beta-cholestane-3alpha,7alpha,12alpha,26-tetrol + H2O + 2 oxidized [adrenodoxin]; Xref=Rhea:RHEA:14373, Rhea:RHEA-COMP:9998, Rhea:RHEA-COMP:9999, ChEBI:CHEBI:15377, ChEBI:CHEBI:15378, ChEBI:CHEBI:15379, ChEBI:CHEBI:16496, ChEBI:CHEBI:33737, ChEBI:CHEBI:33738, ChEBI:CHEBI:48939; Evidence={ECO:0000269 PubMed:11412116, ECO:0000269 PubMed:1708392}; PhysiologicalDirection=left-to-right; Xref=Rhea:RHEA:14374; Evidence=. ;.
UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: Note=kcat/KM=0.005 umol/min for cholesterol and kcat/KM=0.018 umol/min for (25R)-cholest-5-ene-3beta,26-diol {ECO:0000269 PubMed:9660774}; Vmax=0.22 nmol/min/nmol enzyme toward cholesterol {ECO:0000269 PubMed:12077124}; Vmax=0.41 nmol/min/nmol enzyme toward 4beta-hydroxycholesterol {ECO:0000269 PubMed:12077124}; Vmax=0.20 mol/min/mol enzyme toward calciol {ECO:0000269 PubMed:15465040};
GENATLAS Biochemistry:
cytochrome p450,family XXVII A polypeptide 1,vitamin D3 25-hydroxylase,mitochondrial,expressed in liver,also mediating 27-hydroxylation of cholestane triol,a cholesterol metabolite,involved in calcium homeostasis,catalyzing the initial oxidation of sterol intermediates in hepatic bile synthesis

Enzyme Numbers (IUBMB) for CYP27A1 Gene

Phenotypes From GWAS Catalog for CYP27A1 Gene

Gene Ontology (GO) - Molecular Function for CYP27A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005506 iron ion binding IEA --
GO:0008395 steroid hydroxylase activity TAS --
GO:0016491 oxidoreductase activity IEA --
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen IEA --
GO:0020037 heme binding IEA,IDA 9660774
genes like me logo Genes that share ontologies with CYP27A1: view
genes like me logo Genes that share phenotypes with CYP27A1: view

Human Phenotype Ontology for CYP27A1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CYP27A1 Gene

MGI Knock Outs for CYP27A1:

Animal Model Products

CRISPR Products

Clone Products

No data available for miRNA , Transcription Factor Targets and HOMER Transcription for CYP27A1 Gene

Localization for CYP27A1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CYP27A1 Gene

Mitochondrion inner membrane; Peripheral membrane protein. Note=Post-translationally targeted to mitochondria. All three of the receptor proteins in the TOM complex, TOMM70, TOMM20 and TOMM22 are required for the translocation across the mitochondrial outer membrane. After translocation into the matrix, associates with the inner membrane as a membrane extrinsic protein. {ECO:0000250 UniProtKB:P17178}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CYP27A1 gene
Compartment Confidence
mitochondrion 5
peroxisome 2
cytosol 2
plasma membrane 1
extracellular 1
cytoskeleton 1
nucleus 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CYP27A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IDA,IEA --
GO:0005743 mitochondrial inner membrane IEA --
GO:0005759 mitochondrial matrix TAS --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with CYP27A1: view

Pathways & Interactions for CYP27A1 Gene

genes like me logo Genes that share pathways with CYP27A1: view

UniProtKB/Swiss-Prot Q02318-CP27A_HUMAN

  • Pathway: Hormone biosynthesis; cholecalciferol biosynthesis.
  • Pathway: Steroid metabolism; cholesterol degradation.
  • Pathway: Lipid metabolism; bile acid biosynthesis.

SIGNOR curated interactions for CYP27A1 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for CYP27A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006629 lipid metabolic process IEA --
GO:0006694 steroid biosynthetic process IEA --
GO:0006699 bile acid biosynthetic process TAS,IEA --
GO:0006707 cholesterol catabolic process IEA --
GO:0008202 steroid metabolic process IEA --
genes like me logo Genes that share ontologies with CYP27A1: view

Drugs & Compounds for CYP27A1 Gene

(20) Drugs for CYP27A1 Gene - From: DrugBank, PharmGKB, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Ergocalciferol Approved Nutra Enzyme, substrate 1506
Vitamin D3 Approved Nutra Enzyme, substrate Fat-soluble secosteroids 1027,1020
chenodeoxycholic acid Approved Pharma Antagonist, Full agonist, Agonist, Enzyme, substrate 41
cholic acid Approved Pharma Full agonist, Agonist 0
Doxercalciferol Approved Pharma Enzyme, substrate, activator Vitamin D receptor activator, Vitamin D2 analog, VDR agonist 0

(32) Additional Compounds for CYP27A1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
27-Deoxy-5b-cyprinol
  • (3alpha,5beta,7alpha,12alpha)-Cholestane-3,7,12,26-tetrol
  • 3alpha,7alpha,12alpha,26-Tetrahydroxy-5beta-cholestane
  • 5beta-Cholestane 3alpha,7alpha,12alpha,27-tetrol
  • 5beta-Cholestane-3alpha,7alpha,12alpha,26-tetraol
  • Cholestane-3,7,12,26(27)-tetrol
862-53-3
3 alpha,7 alpha,26-Trihydroxy-5beta-cholestane
  • (25R)-5beta-Cholestane-3alpha,7alpha,26-triol
  • (3alpha,5beta,7alpha)-Cholestane-3,7,26-triol
  • 3alpha,7alpha,26-Trihydroxy-5beta-cholestane
  • 5 beta-Cholestane-3 alpha,7 alpha,26-triol
  • 5beta-Cholestan-3alpha,7alpha,26-triol
15313-69-6
3 beta-Hydroxy-5-cholestenoate
  • (3beta)-3-Hydroxy-cholest-5-en-26-Oate
  • (3beta)-3-Hydroxy-cholest-5-en-26-Oic acid
  • 3 beta-Hydroxycholest-5-en-27-Oate
  • 3 beta-Hydroxycholest-5-en-27-Oic acid
  • 3-HCOA
6561-58-6
3a,7a,12a-Trihydroxy-5b-cholestan-26-al
  • (3alpha,5beta,7alpha,12alpha)-3,7,12-Trihydroxycholestan-26-al
  • 3,7,12-Trihydroxycholestan-26-al
  • (3a,5b,7a,12a)-3,7,12-Trihydroxycholestan-26-al
  • (3α,5β,7α,12α)-3,7,12-trihydroxycholestan-26-al
  • (6R)-2-Methyl-6-[(3R,5S,7R,8R,9S,10S,12S,13R,14S,17R)-3,7,12-trihydroxy-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-17-yl]heptanal
3836-01-9
3a,7a-Dihydroxy-5b-cholestan-26-al
  • 3alpha,7alpha-Dihydroxy-5beta-cholestan-27-al
  • 5beta-Cholestan-27-al-3alpha,7alpha-diol
  • 5beta-Cholestane-3alpha,7alpha-diol-27-al
genes like me logo Genes that share compounds with CYP27A1: view

Transcripts for CYP27A1 Gene

mRNA/cDNA for CYP27A1 Gene

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CYP27A1 Gene

ExUns: 1 ^ 2a · 2b · 2c · 2d ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b ^ 7a · 7b · 7c ^ 8 ^ 9 ^ 10 ^ 11
SP1: - -
SP2: -
SP3: - - - - - -
SP4: - - -
SP5: - -

Relevant External Links for CYP27A1 Gene

GeneLoc Exon Structure for
CYP27A1
ECgene alternative splicing isoforms for
CYP27A1

Expression for CYP27A1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CYP27A1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CYP27A1 Gene

This gene is overexpressed in Liver (x12.5).

Protein differential expression in normal tissues from HIPED for CYP27A1 Gene

This gene is overexpressed in Liver (17.5) and Urine (8.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CYP27A1 Gene



Protein tissue co-expression partners for CYP27A1 Gene

NURSA nuclear receptor signaling pathways regulating expression of CYP27A1 Gene:

CYP27A1

SOURCE GeneReport for Unigene cluster for CYP27A1 Gene:

Hs.516700

mRNA Expression by UniProt/SwissProt for CYP27A1 Gene:

Q02318-CP27A_HUMAN
Tissue specificity: Expressed in the neural retina and underlying retinal pigment epithelium (at protein level) (PubMed:21411718). Expressed in the gray and white matter of cerebellum (at protein level) (PubMed:28190002).

Evidence on tissue expression from TISSUES for CYP27A1 Gene

  • Nervous system(4.8)
  • Liver(4.7)
  • Blood(4.6)
  • Intestine(4.5)
  • Kidney(4.5)
  • Lung(2.7)
  • Skin(2.5)
  • Bone(2.3)
  • Adrenal gland(2.1)
  • Muscle(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CYP27A1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • abdominal wall
  • biliary tract
  • gallbladder
  • intestine
  • large intestine
  • liver
  • pancreas
  • small intestine
Pelvis:
  • pelvis
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with CYP27A1: view

Orthologs for CYP27A1 Gene

This gene was present in the common ancestor of animals.

Orthologs for CYP27A1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CYP27A1 33
  • 99 (a)
OneToOne
LOC459951 32
  • 98.93 (n)
dog
(Canis familiaris)
Mammalia CYP27A1 33 32
  • 84.6 (n)
OneToOne
cow
(Bos Taurus)
Mammalia CYP27A1 33 32
  • 82.7 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Cyp27a1 17 33 32
  • 79.21 (n)
rat
(Rattus norvegicus)
Mammalia Cyp27a1 32
  • 79.02 (n)
oppossum
(Monodelphis domestica)
Mammalia CYP27A1 33
  • 62 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia CYP27A1 33
  • 53 (a)
OneToOne
chicken
(Gallus gallus)
Aves CYP27A1 33 32
  • 65.91 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia CYP27A1 33
  • 54 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100496109 32
  • 58.8 (n)
Str.11938 32
African clawed frog
(Xenopus laevis)
Amphibia Xl.2428 32
zebrafish
(Danio rerio)
Actinopterygii zgc:136333 32
  • 57.45 (n)
cyp27a1.2 33
  • 45 (a)
OneToMany
CYP27A1 (6 of 6) 33
  • 45 (a)
OneToMany
cyp27a1.4 33
  • 45 (a)
OneToMany
cyp27a7 33
  • 44 (a)
OneToMany
CYP27A1 (3 of 6) 33
  • 44 (a)
OneToMany
CYP27A1 (5 of 6) 33
  • 38 (a)
OneToMany
wufb58e08 32
fruit fly
(Drosophila melanogaster)
Insecta Cyp49a1 34 32
  • 46.8 (n)
Cyp12b2 34
  • 27 (a)
Cyp12a5 34
  • 27 (a)
Cyp12e1 34
  • 26 (a)
Cyp12a4 34
  • 26 (a)
Cyp301a1 34
  • 25 (a)
Cyp12c1 34
  • 25 (a)
sad 33
  • 24 (a)
OneToMany
Cyp12d1 34
  • 24 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP005774 32
  • 46.24 (n)
Species where no ortholog for CYP27A1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CYP27A1 Gene

ENSEMBL:
Gene Tree for CYP27A1 (if available)
TreeFam:
Gene Tree for CYP27A1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CYP27A1: view image

Paralogs for CYP27A1 Gene

Paralogs for CYP27A1 Gene

(4) SIMAP similar genes for CYP27A1 Gene using alignment to 4 proteins:

  • CP27A_HUMAN
  • C9J1K5_HUMAN
  • F8WD90_HUMAN
  • Q96T86_HUMAN
genes like me logo Genes that share paralogs with CYP27A1: view

Variants for CYP27A1 Gene

Sequence variations from dbSNP and Humsavar for CYP27A1 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1051087 benign, Cholestanol storage disease 218,809,687(+) C/A coding_sequence_variant, intron_variant, synonymous_variant
rs1057519469 likely-pathogenic, Cholestanol storage disease 218,812,926(+) A/T coding_sequence_variant, stop_gained
rs1160640803 pathogenic, Cholestanol storage disease 218,809,720(+) G/A/C coding_sequence_variant, intron_variant, missense_variant, stop_gained
rs1178393503 likely-pathogenic, Cholestanol storage disease 218,814,181(+) CTCT/CT coding_sequence_variant, frameshift
rs1188925314 uncertain-significance, Cholestanol storage disease 218,782,255(+) GCCAGAGCCAAGGCCGCGATCCCTGCC/GCC 5_prime_UTR_variant, coding_sequence_variant, inframe_deletion

Structural Variations from Database of Genomic Variants (DGV) for CYP27A1 Gene

Variant ID Type Subtype PubMed ID
esv3594349 CNV loss 21293372
nsv518750 CNV loss 19592680

Variation tolerance for CYP27A1 Gene

Residual Variation Intolerance Score: 82.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.52; 55.56% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CYP27A1 Gene

Human Gene Mutation Database (HGMD)
CYP27A1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CYP27A1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CYP27A1 Gene

Disorders for CYP27A1 Gene

MalaCards: The human disease database

(13) MalaCards diseases for CYP27A1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
cerebrotendinous xanthomatosis
  • ctx
xanthomatosis
  • xanthomatosis, susceptibility to
lipid storage disease
  • inborn lipid storage disorder
prostate leiomyosarcoma
  • leiomyosarcoma of the prostate
prostate sarcoma
  • sarcoma of the prostate
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

CP27A_HUMAN
  • Cerebrotendinous xanthomatosis (CTX) [MIM:213700]: Rare sterol storage disorder characterized clinically by progressive neurologic dysfunction, premature atherosclerosis, and cataracts. {ECO:0000269 PubMed:12000359, ECO:0000269 PubMed:2019602, ECO:0000269 PubMed:7915755, ECO:0000269 PubMed:9186905, ECO:0000269 PubMed:9790667}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for CYP27A1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CYP27A1: view

No data available for Genatlas for CYP27A1 Gene

Publications for CYP27A1 Gene

  1. Mutations in the bile acid biosynthetic enzyme sterol 27-hydroxylase underlie cerebrotendinous xanthomatosis. (PMID: 2019602) Cali JJ … Russell DW (The Journal of biological chemistry 1991) 2 3 4 23 56
  2. Asthma and genes encoding components of the vitamin D pathway. (PMID: 19852851) Bossé Y … Laprise C (Respiratory research 2009) 3 23 43 56
  3. Vitamin D-related genes, serum vitamin D concentrations and prostate cancer risk. (PMID: 19255064) Ahn J … Prostate, Lung, Colorectal and Ovarian Trial Project Team (Carcinogenesis 2009) 3 23 43 56
  4. Activities of recombinant human cytochrome P450c27 (CYP27) which produce intermediates of alternative bile acid biosynthetic pathways. (PMID: 9660774) Pikuleva IA … Björkhem I (The Journal of biological chemistry 1998) 3 4 23 56
  5. A novel Arg362Ser mutation in the sterol 27-hydroxylase gene (CYP27): its effects on pre-mRNA splicing and enzyme activity. (PMID: 9790667) Chen W … Seyama Y (Biochemistry 1998) 3 4 23 56

Products for CYP27A1 Gene

  • Boster Bio Antibodies for CYP27A1
  • Boster Bio ELISA Kits for CYP27A1

Sources for CYP27A1 Gene