The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009] See more...

Aliases for CUL7 Gene

Aliases for CUL7 Gene

  • Cullin 7 2 3 5
  • KIAA0076 2 3 4
  • DJ20C7.5 2 3
  • Cullin-7 3 4
  • CUL-7 3 4
  • CUL7 5
  • 3M1 3

External Ids for CUL7 Gene

Previous HGNC Symbols for CUL7 Gene

  • KIAA0076

Previous GeneCards Identifiers for CUL7 Gene

  • GC06M043053
  • GC06M043113
  • GC06M042722
  • GC06M043006

Summaries for CUL7 Gene

Entrez Gene Summary for CUL7 Gene

  • The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]

CIViC Summary for CUL7 Gene

GeneCards Summary for CUL7 Gene

CUL7 (Cullin 7) is a Protein Coding gene. Diseases associated with CUL7 include Three M Syndrome 1 and Dubowitz Syndrome. Among its related pathways are Ubiquitin mediated proteolysis and Innate Immune System. Gene Ontology (GO) annotations related to this gene include binding and ubiquitin protein ligase binding. An important paralog of this gene is CUL9.

UniProtKB/Swiss-Prot Summary for CUL7 Gene

  • Core component of the 3M and Cul7-RING(FBXW8) complexes, which mediates the ubiquitination of target proteins. Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer (PubMed:24793695). Interaction with CUL9 is required to inhibit CUL9 activity and ubiquitination of BIRC5 (PubMed:24793696). Core component of a Cul7-RING ubiquitin-protein ligase with FBXW8, which mediates ubiquitination and consequent degradation of target proteins such as GORASP1, IRS1 and MAP4K1/HPK1 (PubMed:21572988, PubMed:24362026). Ubiquitination of GORASP1 regulates Golgi morphogenesis and dendrite patterning in brain (PubMed:21572988). Mediates ubiquitination and degradation of IRS1 in a mTOR-dependent manner: the Cul7-RING(FBXW8) complex recognizes and binds IRS1 previously phosphorylated by S6 kinase (RPS6KB1 or RPS6KB2) (PubMed:18498745). The Cul7-RING(FBXW8) complex also mediates ubiquitination of MAP4K1/HPK1: recognizes and binds autophosphorylated MAP4K1/HPK1, leading to its degradation, thereby affecting cell proliferation and differentiation (PubMed:24362026). Acts as a regulator in trophoblast cell epithelial-mesenchymal transition and placental development (PubMed:20139075). Does not promote polyubiquitination and proteasomal degradation of p53/TP53 (PubMed:16547496, PubMed:17332328). While the Cul7-RING(FBXW8) and the 3M complexes are associated and involved in common processes, CUL7 and the Cul7-RING(FBXW8) complex may be have additional functions.

Gene Wiki entry for CUL7 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for CUL7 Gene

Genomics for CUL7 Gene

GeneHancer (GH) Regulatory Elements Pubs

Promoters and enhancers for CUL7 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CUL7 on the GeneHancer Hub at the UCSC Golden Path

Cistromic (ChIP-Seq) regulation report from SPP (The Signaling Pathways Project) for CUL7

Top Transcription factor binding sites by QIAGEN in the CUL7 gene promoter:
  • E2F
  • E2F-1
  • E2F-2
  • E2F-3a
  • E2F-4
  • E2F-5
  • GR
  • GR-alpha
  • RFX1
  • Sox5

Genomic Locations for CUL7 Gene

Latest Assembly
chr6:43,037,617-43,053,945
(GRCh38/hg38)
Size:
16,329 bases
Orientation:
Minus strand

Previous Assembly
chr6:43,005,355-43,021,589
(GRCh37/hg19 by Entrez Gene)
Size:
16,235 bases
Orientation:
Minus strand

chr6:43,005,355-43,021,683
(GRCh37/hg19 by Ensembl)
Size:
16,329 bases
Orientation:
Minus strand

Genomic View for CUL7 Gene

Genes around CUL7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CUL7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CUL7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CUL7 Gene

Proteins for CUL7 Gene

  • Protein details for CUL7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q14999-CUL7_HUMAN
    Recommended name:
    Cullin-7
    Protein Accession:
    Q14999
    Secondary Accessions:
    • B4DYZ0
    • F5H0L1
    • Q5T654

    Protein attributes for CUL7 Gene

    Size:
    1698 amino acids
    Molecular mass:
    191161 Da
    Quaternary structure:
    • Component of the 3M complex, composed of core components CUL7, CCDC8 and OBSL1. Part of a Cul7-RING complex consisting of CUL7, RBX1, SKP1 and FBXW8. Interacts with a complex of SKP1 and FBXW8, but not with SKP1 alone. Interacts with CUL9; leading to inhibit CUL9 activity. Interacts with FBXW8; interaction is mutually exclusive of binding to CUL9 or p53/TP53. Interacts with p53/TP53; the interaction preferentially involves tetrameric and dimeric p53/TP53. The CUL7-CUL9 heterodimer seems to interact specifically with p53/TP53. Interacts with CUL1; the interactions seems to be mediated by FBXW8. Interacts with OBSL1. Interacts (as part of the 3M complex) with HDAC4 and HDAC5; it is negatively regulated by ANKRA2.
    • (Microbial infection) Interacts with SV40 Large T antigen; this interaction seems to inhibit CUL7.
    SequenceCaution:
    • Sequence=BAA07551.2; Type=Erroneous initiation; Note=Extended N-terminus.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for CUL7 Gene

    Alternative splice isoforms for CUL7 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CUL7 Gene

Post-translational modifications for CUL7 Gene

  • According to a report, may not be neddylated despite the conserved consensus site for neddylation at Lys-1576.
  • Ubiquitination at Lys255 and Lys1431
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for CUL7 Gene

Domains & Families for CUL7 Gene

Gene Families for CUL7 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for CUL7 Gene

GenScript: Design optimal peptide antigens:
  • Cullin-7 (CUL7_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q14999

UniProtKB/Swiss-Prot:

CUL7_HUMAN :
  • Belongs to the cullin family.
Family:
  • Belongs to the cullin family.
genes like me logo Genes that share domains with CUL7: view

Function for CUL7 Gene

Molecular function for CUL7 Gene

UniProtKB/Swiss-Prot Function:
Core component of the 3M and Cul7-RING(FBXW8) complexes, which mediates the ubiquitination of target proteins. Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer (PubMed:24793695). Interaction with CUL9 is required to inhibit CUL9 activity and ubiquitination of BIRC5 (PubMed:24793696). Core component of a Cul7-RING ubiquitin-protein ligase with FBXW8, which mediates ubiquitination and consequent degradation of target proteins such as GORASP1, IRS1 and MAP4K1/HPK1 (PubMed:21572988, PubMed:24362026). Ubiquitination of GORASP1 regulates Golgi morphogenesis and dendrite patterning in brain (PubMed:21572988). Mediates ubiquitination and degradation of IRS1 in a mTOR-dependent manner: the Cul7-RING(FBXW8) complex recognizes and binds IRS1 previously phosphorylated by S6 kinase (RPS6KB1 or RPS6KB2) (PubMed:18498745). The Cul7-RING(FBXW8) complex also mediates ubiquitination of MAP4K1/HPK1: recognizes and binds autophosphorylated MAP4K1/HPK1, leading to its degradation, thereby affecting cell proliferation and differentiation (PubMed:24362026). Acts as a regulator in trophoblast cell epithelial-mesenchymal transition and placental development (PubMed:20139075). Does not promote polyubiquitination and proteasomal degradation of p53/TP53 (PubMed:16547496, PubMed:17332328). While the Cul7-RING(FBXW8) and the 3M complexes are associated and involved in common processes, CUL7 and the Cul7-RING(FBXW8) complex may be have additional functions.

Phenotypes From GWAS Catalog for CUL7 Gene

Gene Ontology (GO) - Molecular Function for CUL7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 17298945
GO:0031625 ubiquitin protein ligase binding IEA --
genes like me logo Genes that share ontologies with CUL7: view
genes like me logo Genes that share phenotypes with CUL7: view

Human Phenotype Ontology for CUL7 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CUL7 Gene

MGI Knock Outs for CUL7:
  • Cul7 Cul7<tm1a(EUCOMM)Wtsi>
  • Cul7 Cul7<tm1Jdec>
  • Cul7 Cul7<tm1Zqp>

miRNA for CUL7 Gene

miRTarBase miRNAs that target CUL7

Inhibitory RNAs for research

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CUL7

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for CUL7 Gene

Localization for CUL7 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CUL7 Gene

Cytoplasm. Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Cytoplasm, perinuclear region. Golgi apparatus. Note=Colocalizes with FBXW8 at the Golgi apparatus in neurons; localization to Golgi is mediated by OBSL1. During mitosis, localizes to the mitotic apparatus (PubMed:24793695). CCDC8 is required for centrosomal location (PubMed:24793695). {ECO:0000269 PubMed:24793695}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CUL7 gene
Compartment Confidence
cytoskeleton 5
nucleus 5
cytosol 5
golgi apparatus 5
plasma membrane 1
extracellular 1
mitochondrion 1
endoplasmic reticulum 1
endosome 1
lysosome 1

Gene Ontology (GO) - Cellular Components for CUL7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005680 anaphase-promoting complex NAS 12481031
GO:0005737 cytoplasm IEA,IDA 24793695
GO:0005794 Golgi apparatus IBA,IDA 21572988
GO:0005813 centrosome IDA 24793695
GO:0005815 microtubule organizing center IEA --
genes like me logo Genes that share ontologies with CUL7: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for CUL7 Gene

Pathways & Interactions for CUL7 Gene

genes like me logo Genes that share pathways with CUL7: view

UniProtKB/Swiss-Prot Q14999-CUL7_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

Gene Ontology (GO) - Biological Process for CUL7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000226 microtubule cytoskeleton organization IEA,IMP 24793695
GO:0000281 mitotic cytokinesis IMP 24793695
GO:0001570 vasculogenesis IEA,ISS --
GO:0001837 epithelial to mesenchymal transition IDA 20139075
GO:0001890 placenta development IDA 20139075
genes like me logo Genes that share ontologies with CUL7: view

No data available for SIGNOR curated interactions for CUL7 Gene

Drugs & Compounds for CUL7 Gene

No Compound Related Data Available

Transcripts for CUL7 Gene

mRNA/cDNA for CUL7 Gene

5 REFSEQ mRNAs :
8 NCBI additional mRNA sequence :
7 Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Inhibitory RNAs for research

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CUL7

Alternative Splicing Database (ASD) splice patterns (SP) for CUL7 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b · 5c ^ 6 ^ 7 ^ 8a · 8b ^ 9a · 9b ^ 10a · 10b · 10c ^ 11a · 11b ^ 12 ^ 13a · 13b · 13c ^ 14 ^
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8: -
SP9:
SP10: -
SP11:
SP12: - -
SP13: -
SP14: -
SP15: - - - - - - - - - - - - - - - - - - - - - -
SP16:
SP17:
SP18:
SP19:
SP20:
SP21:
SP22:

ExUns: 15a · 15b ^ 16 ^ 17 ^ 18a · 18b · 18c ^ 19a · 19b ^ 20a · 20b ^ 21 ^ 22a · 22b · 22c ^ 23 ^ 24a · 24b ^ 25a · 25b ^ 26a · 26b ^ 27 ^ 28 ^ 29a · 29b ·
SP1: - -
SP2: - -
SP3: -
SP4: -
SP5: -
SP6: -
SP7:
SP8:
SP9:
SP10:
SP11: -
SP12:
SP13:
SP14:
SP15: - - - - - - - - -
SP16: - -
SP17: -
SP18:
SP19:
SP20:
SP21:
SP22:

ExUns: 29c · 29d ^ 30a · 30b
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:
SP11:
SP12:
SP13:
SP14:
SP15:
SP16:
SP17:
SP18:
SP19:
SP20:
SP21:
SP22:

Relevant External Links for CUL7 Gene

GeneLoc Exon Structure for
CUL7

Expression for CUL7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for CUL7 Gene

Protein differential expression in normal tissues from HIPED for CUL7 Gene

This gene is overexpressed in Nasal epithelium (45.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CUL7 Gene



Transcriptomic regulation report from SPP (The Signaling Pathways Project) for CUL7

SOURCE GeneReport for Unigene cluster for CUL7 Gene:

Hs.520136

mRNA Expression by UniProt/SwissProt for CUL7 Gene:

Q14999-CUL7_HUMAN
Tissue specificity: Highly expressed in fetal kidney and adult skeletal muscle. Also abundant in fetal brain, as well as in adult pancreas, kidney, placenta and heart. Detected in trophoblasts, lymphoblasts, osteoblasts, chondrocytes and skin fibroblasts.

Evidence on tissue expression from TISSUES for CUL7 Gene

  • Eye(4.1)
  • Bone marrow(4.1)
  • Nervous system(3.7)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CUL7 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cheek
  • chin
  • ear
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • outer ear
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Pelvis:
  • pelvis
  • penis
  • testicle
  • urethra
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • hair
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with CUL7: view

Primer products for research

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Protein tissue co-expression partners for CUL7 Gene

Orthologs for CUL7 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CUL7 Gene

Organism Taxonomy Gene Similarity Type Details
Chimpanzee
(Pan troglodytes)
Mammalia CUL7 30 31
  • 99.57 (n)
OneToOne
Dog
(Canis familiaris)
Mammalia CUL7 30 31
  • 88.57 (n)
OneToOne
Cow
(Bos Taurus)
Mammalia CUL7 30 31
  • 87.97 (n)
OneToOne
Rat
(Rattus norvegicus)
Mammalia LOC680835 30
  • 82.64 (n)
Mouse
(Mus musculus)
Mammalia Cul7 30 17 31
  • 81.46 (n)
OneToOne
Oppossum
(Monodelphis domestica)
Mammalia -- 31
  • 59 (a)
ManyToMany
-- 31
  • 41 (a)
ManyToMany
Platypus
(Ornithorhynchus anatinus)
Mammalia -- 31
  • 51 (a)
ManyToMany
-- 31
  • 49 (a)
ManyToMany
-- 31
  • 32 (a)
ManyToMany
Chicken
(Gallus gallus)
Aves -- 31
  • 16 (a)
OneToMany
Lizard
(Anolis carolinensis)
Reptilia -- 31
  • 49 (a)
ManyToMany
-- 31
  • 42 (a)
ManyToMany
-- 31
  • 32 (a)
ManyToMany
Zebrafish
(Danio rerio)
Actinopterygii CABZ01087282.2 31
  • 42 (a)
ManyToMany
CABZ01087282.1 31
  • 34 (a)
ManyToMany
Sea Squirt
(Ciona savignyi)
Ascidiacea -- 31
  • 29 (a)
OneToMany
Species where no ortholog for CUL7 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Eremothecium gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • Alpha proteobacteria (Wolbachia pipientis)
  • Amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • Baker's yeast (Saccharomyces cerevisiae)
  • Barley (Hordeum vulgare)
  • Beta proteobacteria (Neisseria meningitidis)
  • Bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • Common water flea (Daphnia pulex)
  • Corn (Zea mays)
  • E. coli (Escherichia coli)
  • Filamentous fungi (Aspergillus nidulans)
  • Firmicute Bacteria (Streptococcus pneumoniae)
  • Fission Yeast (Schizosaccharomyces pombe)
  • Fruit Fly (Drosophila melanogaster)
  • Green Algae (Chlamydomonas reinhardtii)
  • Honey Bee (Apis mellifera)
  • K. Lactis Yeast (Kluyveromyces lactis)
  • Loblloly Pine (Pinus taeda)
  • Malaria Parasite (Plasmodium falciparum)
  • Medicago Trunc (Medicago Truncatula)
  • Moss (Physcomitrella patens)
  • Orangutan (Pongo pygmaeus)
  • Pig (Sus scrofa)
  • Rainbow Trout (Oncorhynchus mykiss)
  • Rice (Oryza sativa)
  • Rice Blast Fungus (Magnaporthe grisea)
  • Schistosome Parasite (Schistosoma mansoni)
  • Sea Anemone (Nematostella vectensis)
  • Sea Vase (Ciona intestinalis)
  • Sea Urchin (Strongylocentrotus purpuratus)
  • Sorghum (Sorghum bicolor)
  • Soybean (Glycine max)
  • Stem Rust Fungus (Puccinia graminis)
  • Sugarcane (Saccharum officinarum)
  • Thale Cress (Arabidopsis thaliana)
  • Tomato (Lycopersicon esculentum)
  • Toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • Tropical Clawed Frog (Silurana tropicalis)
  • Wheat (Triticum aestivum)
  • Worm (Caenorhabditis elegans)

Evolution for CUL7 Gene

ENSEMBL:
Gene Tree for CUL7 (if available)
TreeFam:
Gene Tree for CUL7 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CUL7: view image

Paralogs for CUL7 Gene

Paralogs for CUL7 Gene

(1) SIMAP similar genes for CUL7 Gene using alignment to 2 proteins:

  • CUL7_HUMAN
  • L8E835_HUMAN
genes like me logo Genes that share paralogs with CUL7: view

Variants for CUL7 Gene

Sequence variations, with clinical significance, from ClinVar and Humsavar, with links to dbSNP for CUL7 Gene

SNP ID Clinical significance and condition Chr 06 pos Variation AA Info Type
631981 Uncertain Significance: Three M syndrome 1 43,045,659(-) GCTGGCAGAGGGCATC
NM_014780.4(CUL7):c.2767_2789delGTGAATGTGATGCCCTCTGCCAG
800566 Likely Pathogenic: Three M syndrome 1 43,040,971(-) T/TTGCAGGCATTGCT
NM_014780.5(CUL7):c.3722_3749dup (p.Val1252fs)
FRAMESHIFT
840959 Uncertain Significance: not provided 43,052,326(-) C/T
NM_014780.5(CUL7):c.463G>A (p.Gly155Arg)
MISSENSE
908444 Uncertain Significance: Three M syndrome 1 43,040,381(-) C/T
NM_014780.5(CUL7):c.4069G>A (p.Glu1357Lys)
MISSENSE
908445 Uncertain Significance: Three M syndrome 1 43,040,391(-) G/A
NM_014780.5(CUL7):c.4059C>T (p.Ser1353=)
SYNONYMOUS

dbSNP identifiers (rs#s) for variants without ClinVar clinical significance for CUL7 Gene

All consequence types are included: molecular consequences (e.g. missense, synonymous), and location-based (e.g. intron, upstream).

Structural Variations from Database of Genomic Variants (DGV) for CUL7 Gene

Variant ID Type Subtype PubMed ID
dgv10640n54 CNV loss 21841781
nsv1017398 CNV gain 25217958
nsv462927 CNV loss 19166990
nsv462930 CNV loss 19166990
nsv602992 CNV loss 21841781

Variation tolerance for CUL7 Gene

Residual Variation Intolerance Score: 42.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.40; 71.14% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CUL7 Gene

Human Gene Mutation Database (HGMD)
CUL7
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CUL7

SNP Genotyping and Copy Number Assays for research

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CUL7 Gene

Disorders for CUL7 Gene

MalaCards: The human disease database

(5) MalaCards diseases for CUL7 Gene - From: OMI, CVR, GTR, ORP, SWI, COP, and GCD

- elite association - COSMIC cancer census association via MalaCards
Search CUL7 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CUL7_HUMAN
  • 3M syndrome 1 (3M1) [MIM:273750]: An autosomal recessive disorder characterized by severe pre- and postnatal growth retardation, facial dysmorphism, large head circumference, and normal intelligence and endocrine function. Skeletal changes include long slender tubular bones and tall vertebral bodies. {ECO:0000269 PubMed:16142236, ECO:0000269 PubMed:17675530, ECO:0000269 PubMed:23018678}. Note=The disease is caused by variants affecting the gene represented in this entry.

Additional Disease Information for CUL7

genes like me logo Genes that share disorders with CUL7: view

No data available for Genatlas for CUL7 Gene

Publications for CUL7 Gene

  1. Clinical, molecular and histopathological features of short stature syndrome with novel CUL7 mutation in Yakuts: new population isolate in Asia. (PMID: 17675530) Maksimova N … Onodera O (Journal of medical genetics 2007) 3 4 23 74
  2. CUL7: A DOC domain-containing cullin selectively binds Skp1.Fbx29 to form an SCF-like complex. (PMID: 12481031) Dias DC … Pan ZQ (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 4 23
  3. Ubiquitin ligase cullin 7 induces epithelial-mesenchymal transition in human choriocarcinoma cells. (PMID: 20139075) Fu J … Wang H (The Journal of biological chemistry 2010) 3 4 23
  4. Identification of mutations in CUL7 in 3-M syndrome. (PMID: 16142236) Huber C … Cormier-Daire V (Nature genetics 2005) 3 4 23
  5. Targeted disruption of p185/Cul7 gene results in abnormal vascular morphogenesis. (PMID: 12904573) Arai T … DeCaprio JA (Proceedings of the National Academy of Sciences of the United States of America 2003) 2 3 4

Products for CUL7 Gene

Sources for CUL7 Gene