Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CTU2 Gene

Aliases for CTU2 Gene

  • Cytosolic Thiouridylase Subunit 2 2 3 4 5
  • C16orf84 3 4
  • NCS2 3 4
  • Cytosolic Thiouridylase Subunit 2 Homolog (S. Pombe) 2
  • Cytosolic Thiouridylase Subunit 2 Homolog 3
  • Cytoplasmic TRNA 2-Thiolation Protein 2 3
  • Chromosome 16 Open Reading Frame 84 2
  • UPF0432 3

External Ids for CTU2 Gene

Previous HGNC Symbols for CTU2 Gene

  • C16orf84

Previous GeneCards Identifiers for CTU2 Gene

  • GC16P087301
  • GC16P088773
  • GC16P074467

Summaries for CTU2 Gene

Entrez Gene Summary for CTU2 Gene

  • This gene encodes a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs). The encoded protein plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]

GeneCards Summary for CTU2 Gene

CTU2 (Cytosolic Thiouridylase Subunit 2) is a Protein Coding gene. Diseases associated with CTU2 include Phobia, Specific and Exotropia. Among its related pathways are Gene Expression and tRNA processing. Gene Ontology (GO) annotations related to this gene include tRNA binding and nucleotidyltransferase activity.

UniProtKB/Swiss-Prot for CTU2 Gene

  • Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). May act by forming a heterodimer with CTU1/ATPBD3 that ligates sulfur from thiocarboxylated URM1 onto the uridine of tRNAs at wobble position.

Gene Wiki entry for CTU2 Gene

Additional gene information for CTU2 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CTU2 Gene

Genomics for CTU2 Gene

GeneHancer (GH) Regulatory Elements for CTU2 Gene

Promoters and enhancers for CTU2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16I088698 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 562.6 -3.6 -3632 9.4 HDGF PKNOX1 SMAD1 MLX ARNT ARID4B SIN3A DMAP1 YY1 CBX5 RNF166 CTU2 SNAI3-AS1 SNAI3 ENSG00000260121 PIEZO1 CDK10 ZC3H18 APRT CYBA
GH16I089558 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 19 +856.2 856163 7.9 CLOCK MLX DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC RPL13 SNORD68 GC16P089560 GC16P089561 PIR32702 AFG3L1P ANKRD11 TCF25 ENSG00000268218 ENSG00000259877
GH16I088809 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 20.3 +104.8 104814 4.4 CLOCK MLX ZFP64 FEZF1 DMAP1 YY1 ZNF213 E2F8 ZNF143 ZNF548 APRT ENSG00000259877 SNORD68 GALNS ANKRD11 LOC101927863 RPL13 ENSG00000260121 ZC3H18 ACSF3
GH16I088329 Enhancer 1.8 FANTOM5 Ensembl ENCODE dbSUPER 20.9 -373.6 -373607 6 HDGF PKNOX1 ARNT SIN3A YBX1 ZBTB7B POLR2B ZNF766 ZNF207 FOS ENSG00000259877 ACSF3 ZC3H18 BANP ENSG00000268218 ENSG00000260121 ZCCHC14 CTU2 GALNS PIEZO1
GH16I089480 Promoter/Enhancer 2.9 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.3 +780.3 780291 12 CLOCK MLX FEZF1 DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 ZNF548 ANKRD11 SPG7 ZNF778 ZC3H18 AFG3L1P MC1R ENSG00000259877 RPL13 TCF25 RNU6-430P
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CTU2 on UCSC Golden Path with GeneCards custom track

Genomic Locations for CTU2 Gene

Genomic Locations for CTU2 Gene
8,924 bases
Plus strand

Genomic View for CTU2 Gene

Genes around CTU2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CTU2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CTU2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CTU2 Gene

Proteins for CTU2 Gene

  • Protein details for CTU2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Cytoplasmic tRNA 2-thiolation protein 2
    Protein Accession:
    Secondary Accessions:
    • B2RXK0
    • Q0P511
    • Q66K78
    • Q6P4C8
    • Q86SV4

    Protein attributes for CTU2 Gene

    515 amino acids
    Molecular mass:
    56107 Da
    Quaternary structure:
    • Component of a complex at least composed of URM1, CTU2/NCS2 and CTU1/ATPBD3.

    Alternative splice isoforms for CTU2 Gene


neXtProt entry for CTU2 Gene

Post-translational modifications for CTU2 Gene

No Post-translational modifications

No data available for DME Specific Peptides for CTU2 Gene

Domains & Families for CTU2 Gene

Gene Families for CTU2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for CTU2 Gene

Suggested Antigen Peptide Sequences for CTU2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the CTU2/NCS2 family.
  • Belongs to the CTU2/NCS2 family.
genes like me logo Genes that share domains with CTU2: view

Function for CTU2 Gene

Molecular function for CTU2 Gene

UniProtKB/Swiss-Prot Function:
Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). May act by forming a heterodimer with CTU1/ATPBD3 that ligates sulfur from thiocarboxylated URM1 onto the uridine of tRNAs at wobble position.

Phenotypes From GWAS Catalog for CTU2 Gene

Gene Ontology (GO) - Molecular Function for CTU2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000049 tRNA binding IEA --
GO:0005515 protein binding IPI 19017811
GO:0016779 nucleotidyltransferase activity IEA --
GO:0016783 sulfurtransferase activity IBA --
genes like me logo Genes that share ontologies with CTU2: view
genes like me logo Genes that share phenotypes with CTU2: view

Animal Model Products

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for CTU2 Gene

Localization for CTU2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CTU2 Gene


Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CTU2 gene
Compartment Confidence
cytosol 5
mitochondrion 3
nucleus 3
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CTU2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol TAS,IBA --
GO:0043234 protein complex IDA 19017811
genes like me logo Genes that share ontologies with CTU2: view

Pathways & Interactions for CTU2 Gene

genes like me logo Genes that share pathways with CTU2: view

Pathways by source for CTU2 Gene

1 KEGG pathway for CTU2 Gene

UniProtKB/Swiss-Prot Q2VPK5-CTU2_HUMAN

  • Pathway: tRNA modification; 5-methoxycarbonylmethyl-2-thiouridine-tRNA biosynthesis.

Gene Ontology (GO) - Biological Process for CTU2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002098 tRNA wobble uridine modification IEA,NAS 19017811
GO:0002143 tRNA wobble position uridine thiolation IBA --
GO:0006400 tRNA modification TAS --
GO:0008033 tRNA processing IEA --
GO:0032447 protein urmylation IEA --
genes like me logo Genes that share ontologies with CTU2: view

No data available for SIGNOR curated interactions for CTU2 Gene

Drugs & Compounds for CTU2 Gene

No Compound Related Data Available

Transcripts for CTU2 Gene

mRNA/cDNA for CTU2 Gene

(5) REFSEQ mRNAs :
(9) Additional mRNA sequences :
(10) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CTU2 Gene

Cytosolic thiouridylase subunit 2 homolog (S. pombe):
Representative Sequences:

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for CTU2 Gene

No ASD Table

Relevant External Links for CTU2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CTU2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CTU2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for CTU2 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (18.9) and Blymphocyte (15.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for CTU2 Gene

Protein tissue co-expression partners for CTU2 Gene

NURSA nuclear receptor signaling pathways regulating expression of CTU2 Gene:


SOURCE GeneReport for Unigene cluster for CTU2 Gene:


Evidence on tissue expression from TISSUES for CTU2 Gene

  • Nervous system(4.3)
  • Skin(4.1)
genes like me logo Genes that share expression patterns with CTU2: view

Primer Products

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CTU2 Gene

Orthologs for CTU2 Gene

This gene was present in the common ancestor of animals.

Orthologs for CTU2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CTU2 33 34
  • 99.03 (n)
(Canis familiaris)
Mammalia CTU2 33 34
  • 81.47 (n)
(Bos Taurus)
Mammalia CTU2 33 34
  • 80.48 (n)
(Mus musculus)
Mammalia Ctu2 33 16 34
  • 79.07 (n)
(Rattus norvegicus)
Mammalia Ctu2 33
  • 78.44 (n)
(Monodelphis domestica)
Mammalia CTU2 34
  • 65 (a)
(Ornithorhynchus anatinus)
Mammalia CTU2 34
  • 59 (a)
(Gallus gallus)
Aves CTU2 33 34
  • 63.85 (n)
(Anolis carolinensis)
Reptilia CTU2 34
  • 53 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ctu2 33
  • 56.53 (n)
(Danio rerio)
Actinopterygii ctu2 33 34
  • 58.18 (n)
wufe06e11 33
fruit fly
(Drosophila melanogaster)
Insecta CG10189 33 34
  • 46.23 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta CTU2_ANOGA 33
  • 46.11 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.3713 34
  • 38 (a)
-- 34
  • 27 (a)
Species where no ortholog for CTU2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CTU2 Gene

Gene Tree for CTU2 (if available)
Gene Tree for CTU2 (if available)

Paralogs for CTU2 Gene

No data available for Paralogs for CTU2 Gene

Variants for CTU2 Gene

Sequence variations from dbSNP and Humsavar for CTU2 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs587776988 pathogenic, Xerocytosis 88,715,804(+) C/T downstream_transcript_variant
rs587776992 pathogenic, Xerocytosis, not provided 88,715,683(+) CTCCAGCTCCAGCTCC/CTCCAGCTCC/CTCCAGCTCCAGCTCCAGCTCC downstream_transcript_variant
rs1061228 benign, not specified 88,715,671(+) G/A/C/T downstream_transcript_variant
rs149847195 benign, not specified 88,714,228(+) GTGTG/GTGTGTGTG/GTGTGTGTGGGTGTGTGTG intron_variant, splice_donor_variant
rs35544968 benign, not specified 88,715,809(+) G/A downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for CTU2 Gene

Variant ID Type Subtype PubMed ID
nsv952070 CNV deletion 24416366
nsv833327 CNV loss 17160897
nsv517643 CNV loss 19592680
nsv499595 CNV gain 21111241
nsv482951 CNV loss 15286789
nsv471114 CNV gain 18288195
nsv471113 CNV loss 18288195
nsv1927 CNV insertion 18451855
nsv1160442 CNV deletion 26073780
nsv1119453 CNV insertion 24896259
nsv1065973 CNV loss 25217958
nsv1063024 CNV gain 25217958
nsv1061256 CNV gain 25217958
esv3553875 CNV deletion 23714750
esv2715026 CNV deletion 23290073
esv2715025 CNV deletion 23290073
esv1056304 CNV insertion 17803354
dgv3065n100 CNV gain 25217958
dgv3064n100 CNV gain 25217958

Variation tolerance for CTU2 Gene

Residual Variation Intolerance Score: 97% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 17.35; 98.16% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CTU2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CTU2 Gene

Disorders for CTU2 Gene

MalaCards: The human disease database

(2) MalaCards diseases for CTU2 Gene - From: HGMD and DISEASES

Disorder Aliases PubMed IDs
phobia, specific
  • phobia, simple
  • divergent concomitant strabismus
- elite association - COSMIC cancer census association via MalaCards
Search CTU2 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for CTU2

genes like me logo Genes that share disorders with CTU2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CTU2 Gene

Publications for CTU2 Gene

  1. A functional proteomics approach links the ubiquitin-related modifier Urm1 to a tRNA modification pathway. (PMID: 19017811) Schlieker CD … Ploegh HL (Proceedings of the National Academy of Sciences of the United States of America 2008) 2 3 4 58
  2. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  3. A genome-wide association study of autism using the Simons Simplex Collection: Does reducing phenotypic heterogeneity in autism increase genetic homogeneity? (PMID: 25534755) Chaste P … Devlin B (Biological psychiatry 2015) 3 58
  4. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 58
  5. Toward a comprehensive characterization of a human cancer cell phosphoproteome. (PMID: 23186163) Zhou H … Mohammed S (Journal of proteome research 2013) 4 58

Products for CTU2 Gene

Sources for CTU2 Gene

Loading form....