Free for academic non-profit institutions. Other users need a Commercial license

CTSK Gene(Protein Coding)

Cathepsin K

GCID:
GC01M150768
GIFtS:
55
Genes Participants
UDN Logo

Aliases for CTSK Gene

Aliases for CTSK Gene

  • Cathepsin K 2 3 3 5
  • Cathepsin O2 3 4
  • Cathepsin O 3 4
  • Cathepsin X 3 4
  • CTSO2 3 4
  • CTSO 3 4
  • Cathepsin K (Pycnodysostosis) 2
  • Cathepsin O1 3
  • EC 3.4.22.38 4
  • CTS02 3
  • CTSO1 3
  • PKND 3
  • PYCD 3

External Ids for CTSK Gene

Previous HGNC Symbols for CTSK Gene

  • CTSO2
  • CTSO
  • PYCD

Previous GeneCards Identifiers for CTSK Gene

  • GC01M148610
  • GC01M146515
  • GC01M147543
  • GC01M147985
  • GC01M147581
  • GC01M149035
  • GC01M122146

Summaries for CTSK Gene

Entrez Gene Summary for CTSK Gene

  • The protein encoded by this gene is a lysosomal cysteine proteinase involved in bone remodeling and resorption. This protein, which is a member of the peptidase C1 protein family, is predominantly expressed in osteoclasts. However, the encoded protein is also expressed in a significant fraction of human breast cancers, where it could contribute to tumor invasiveness. Mutations in this gene are the cause of pycnodysostosis, an autosomal recessive disease characterized by osteosclerosis and short stature. [provided by RefSeq, Apr 2013]

GeneCards Summary for CTSK Gene

CTSK (Cathepsin K) is a Protein Coding gene. Diseases associated with CTSK include Pycnodysostosis and Endosteal Hyperostosis, Autosomal Dominant. Among its related pathways are Rheumatoid arthritis and Activated TLR4 signalling. Gene Ontology (GO) annotations related to this gene include cysteine-type endopeptidase activity and collagen binding. An important paralog of this gene is CTSS.

UniProtKB/Swiss-Prot for CTSK Gene

  • Closely involved in osteoclastic bone resorption and may participate partially in the disorder of bone remodeling. Displays potent endoprotease activity against fibrinogen at acid pH. May play an important role in extracellular matrix degradation.

Tocris Summary for CTSK Gene

  • Cathepsins are a group of lysosomal proteases that have a key role in cellular protein turnover. The term cathepsin includes serine proteases (cathepsins A and G), aspartic proteases (cathepsin D and E) as well as the cysteine proteases (cathepsins B, C, F, H, K, L, O, S, W and Z).

Gene Wiki entry for CTSK Gene

Additional gene information for CTSK Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CTSK Gene

Genomics for CTSK Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for CTSK Gene

Promoters and enhancers for CTSK Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH01J150806 Promoter/Enhancer 1.4 EPDnew Ensembl ENCODE 650.7 -0.2 -216 4.4 PKNOX1 ZSCAN4 ZNF195 ZIC2 ZNF2 CTBP1 ZNF366 TCF7L2 ZNF189 ZIK1 CTSK HORMAD1 ARNT VPS45 BNIPL LINGO4 RNU6-1309P GC01M150812
GH01J151068 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 58 -262.0 -262045 3.3 CLOCK FEZF1 IRF4 YY1 ZNF213 E2F8 ZNF416 ZNF143 ZNF548 SP3 GABPB2 CDC42SE1 SETDB1 PRPF3 PI4KB PIP5K1A MRPL9 UBE2D3P3 ARNT ZNF687
GH01J150557 Promoter/Enhancer 2.6 EPDnew Ensembl ENCODE dbSUPER 41.7 +239.1 239137 23.1 CLOCK MLX DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 SP3 NFYC RN7SL600P MCL1 SETDB1 PIP5K1A PI4KB PRPF3 ARNT GOLPH3L HORMAD1 SF3B4
GH01J149883 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 44.1 +921.7 921738 5.9 CLOCK MLX ZFP64 FEZF1 IRF4 YY1 ZNF213 E2F8 ZNF143 SP3 HIST2H2AB GC01M149896 BOLA1 HIST2H2BE HIST2H2AC HIST2H2BF PRPF3 SF3B4 UBE2D3P3 ARNT
GH01J151164 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 44.2 -357.6 -357608 3.1 CLOCK DMAP1 IRF4 YY1 E2F8 ZNF143 SP3 NFYC MEF2D ZNF610 LYSMD1 SCNM1 PRPF3 SETDB1 PI4KB ARNT UBE2D3P3 ZNF687 PIP5K1A CTSK
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CTSK on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CTSK gene promoter:
  • ATF-2
  • c-Jun
  • AP-1
  • ATF
  • Nkx3-1 v1
  • Pax-5
  • GATA-1
  • Nkx3-1
  • Nkx3-1 v2
  • Nkx3-1 v3

Genomic Locations for CTSK Gene

Genomic Locations for CTSK Gene
chr1:150,796,208-150,808,441
(GRCh38/hg38)
Size:
12,234 bases
Orientation:
Minus strand
chr1:150,768,684-150,780,917
(GRCh37/hg19)
Size:
12,234 bases
Orientation:
Minus strand

Genomic View for CTSK Gene

Genes around CTSK on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CTSK Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CTSK Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for CTSK Gene

Proteins for CTSK Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for CTSK Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P43235-CATK_HUMAN
    Recommended name:
    Cathepsin K
    Protein Accession:
    P43235
    Secondary Accessions:
    • Q6FHS6

    Protein attributes for CTSK Gene

    Size:
    329 amino acids
    Molecular mass:
    36966 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for CTSK Gene

neXtProt entry for CTSK Gene

Protein Expression for CTSK Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for CTSK Gene

  • Glycosylation at Asn103
  • Modification sites at PhosphoSitePlus

Other Protein References for CTSK Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for CTSK Gene

Domains & Families for CTSK Gene

Gene Families for CTSK Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted membrane proteins
  • Predicted secreted proteins

Protein Domains for CTSK Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for CTSK Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P43235

UniProtKB/Swiss-Prot:

CATK_HUMAN :
  • Belongs to the peptidase C1 family.
Family:
  • Belongs to the peptidase C1 family.
genes like me logo Genes that share domains with CTSK: view

Function for CTSK Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for CTSK Gene

UniProtKB/Swiss-Prot Function:
Closely involved in osteoclastic bone resorption and may participate partially in the disorder of bone remodeling. Displays potent endoprotease activity against fibrinogen at acid pH. May play an important role in extracellular matrix degradation.
UniProtKB/Swiss-Prot CatalyticActivity:
Broad proteolytic activity. With small-molecule substrates and inhibitors, the major determinant of specificity is P2, which is preferably Leu, Met > Phe, and not Arg.
GENATLAS Biochemistry:
cathepsin K,lysosomal P cysteine proteinase,expressed in osteoclats and multinucleated and chondroclasts at the osteochondral junction and the surfaces bone spicules,likely major protein in bone matrix resorption

Enzyme Numbers (IUBMB) for CTSK Gene

Phenotypes From GWAS Catalog for CTSK Gene

Gene Ontology (GO) - Molecular Function for CTSK Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001968 fibronectin binding IPI 22952693
GO:0004197 cysteine-type endopeptidase activity IDA 22952693
GO:0004252 serine-type endopeptidase activity TAS --
GO:0005515 protein binding IPI 12504904
GO:0005518 collagen binding IDA 22952693
genes like me logo Genes that share ontologies with CTSK: view
genes like me logo Genes that share phenotypes with CTSK: view

Human Phenotype Ontology for CTSK Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CTSK Gene

MGI Knock Outs for CTSK:
  • Ctsk Ctsk<tm1Psa>
  • Ctsk Ctsk<tm1Ypl>
  • Ctsk Ctsk<tm1b(EUCOMM)Hmgu>
  • Ctsk Ctsk<tm1(cre)Ska>
  • Ctsk Ctsk<tm1Mbs>
  • Ctsk Ctsk<tm1Vuo>

Animal Model Products

miRNA for CTSK Gene

miRTarBase miRNAs that target CTSK

Clone Products

No data available for Transcription Factor Targets and HOMER Transcription for CTSK Gene

Localization for CTSK Gene

Subcellular locations from UniProtKB/Swiss-Prot for CTSK Gene

Lysosome.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CTSK gene
Compartment Confidence
extracellular 5
nucleus 5
lysosome 5
endosome 5
plasma membrane 2
cytoskeleton 2
mitochondrion 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Vesicles (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for CTSK Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space IDA,IEA 22952693
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm IEA --
GO:0005764 lysosome IBA --
genes like me logo Genes that share ontologies with CTSK: view

Pathways & Interactions for CTSK Gene

genes like me logo Genes that share pathways with CTSK: view

Gene Ontology (GO) - Biological Process for CTSK Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000422 autophagy of mitochondrion HMP 24912190
GO:0001957 intramembranous ossification IEA --
GO:0002224 toll-like receptor signaling pathway TAS --
GO:0006508 proteolysis IEA,TAS 7818555
GO:0022617 extracellular matrix disassembly TAS --
genes like me logo Genes that share ontologies with CTSK: view

No data available for SIGNOR curated interactions for CTSK Gene

Drugs & Compounds for CTSK Gene

Products:

  1. Drug

(46) Drugs for CTSK Gene - From: DrugBank, DGIdb, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
(1R,2R)-N-(2-Aminoethyl)-2-{[(4-methoxyphenyl)sulfonyl]methyl}cyclohexanecarboxamide Experimental Pharma Target 0
(2R)-2-(3-Biphenylyl)-N-{(2R)-2-hydroxy-3-[(2-pyridinylsulfonyl)amino]propyl}-4-methylpentanamide Experimental Pharma Target 0
(2R)-3-Methyl-1-phenyl-2-butanyl [(2S)-1-oxo-2-hexanyl]carbamate Experimental Pharma Target 0
[1-(4-Fluorobenzyl)Cyclobutyl]Methyl (1s)-1-[Oxo(1h-Pyrazol-5-Ylamino)Acetyl]Pentylcarbamate Experimental Pharma Target 0
1-(PHENYLMETHYL)CYCLOPENTYL[(1S)-1-FORMYLPENTYL]CARBAMATE Experimental Pharma Target 0

(18) Additional Compounds for CTSK Gene - From: Novoseek and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
N-Acetyl-L-leucyl-L-leucyl-L-methional
136632-32-1

(4) Tocris Compounds for CTSK Gene

Compound Action Cas Number
E 64d Cathepsin inhibitor; interferes with autolysosomal digestion 88321-09-9
L 006235 Potent cathepsin K inhibitor 294623-49-7
N-Acetyl-L-leucyl-L-leucyl-L-methional Cathepsin inhibitor 136632-32-1
SID 26681509 Cathepsin L inhibitor 958772-66-2
genes like me logo Genes that share compounds with CTSK: view

Transcripts for CTSK Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for CTSK Gene

(1) REFSEQ mRNAs :
(9) Additional mRNA sequences :
(688) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CTSK Gene

Cathepsin K:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CTSK Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3 ^ 4a · 4b · 4c ^ 5 ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10
SP1: -
SP2: -
SP3: - - - -
SP4: -
SP5:
SP6: -

Relevant External Links for CTSK Gene

GeneLoc Exon Structure for
CTSK
ECgene alternative splicing isoforms for
CTSK

Expression for CTSK Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CTSK Gene

mRNA expression in normal human tissues for CTSK Gene
mRNA expression by GTEx for CTSK GenemRNA expression by BioGPS for CTSK Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CTSK Gene

This gene is overexpressed in Cervix - Ectocervix (x5.7) and Cervix - Endocervix (x4.7).

Protein differential expression in normal tissues from HIPED for CTSK Gene

This gene is overexpressed in Heart (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CTSK Gene



Protein tissue co-expression partners for CTSK Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of CTSK Gene:

CTSK

SOURCE GeneReport for Unigene cluster for CTSK Gene:

Hs.632466

mRNA Expression by UniProt/SwissProt for CTSK Gene:

P43235-CATK_HUMAN
Tissue specificity: Predominantly expressed in osteoclasts (bones).

Evidence on tissue expression from TISSUES for CTSK Gene

  • Bone(4.8)
  • Skin(4.7)
  • Blood(4.5)
  • Spleen(4.4)
  • Kidney(3.2)
  • Lung(3.1)
  • Nervous system(3.1)
  • Pancreas(2.9)
  • Bone marrow(2.7)
  • Gall bladder(2.3)
  • Muscle(2.3)
  • Eye(2.2)
  • Lymph node(2.1)
  • Heart(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CTSK Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • digestive
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • chin
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • sinus
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Pelvis:
  • pelvis
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • nail
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • skin
  • spinal column
  • vertebrae
genes like me logo Genes that share expression patterns with CTSK: view

Orthologs for CTSK Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for CTSK Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia CTSK 34 33
  • 99.59 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia CTSK 34 33
  • 93.41 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia CTSK 34 33
  • 93.31 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Ctsk 33
  • 87.54 (n)
mouse
(Mus musculus)
 Mammalia Ctsk 16 34 33
  • 87.13 (n)
oppossum
(Monodelphis domestica)
 Mammalia CTSK 34
  • 87 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia CTSK 34
  • 81 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves CTSK 34 33
  • 66.56 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia CTSK 34
  • 85 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia ctsk 33
  • 68.42 (n)
zebrafish
(Danio rerio)
 Actinopterygii ctsk 34 33
  • 65.58 (n)
 OneToOne
wufb08b05 33
fruit fly
(Drosophila melanogaster)
 Insecta Cp1 35
  • 47 (a)
CG4847 35
  • 39 (a)
26-29kD-proteinase 35
  • 39 (a)
CG11459 35
  • 35 (a)
worm
(Caenorhabditis elegans)
 Secernentea cpl-1 35
  • 46 (a)
R07E3.1 35
  • 37 (a)
R09F10.1 35
  • 32 (a)
rice
(Oryza sativa)
 Liliopsida Os11g0255300 33
  • 50.8 (n)
Species where no ortholog for CTSK was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CTSK Gene

ENSEMBL:
Gene Tree for CTSK (if available)
TreeFam:
Gene Tree for CTSK (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CTSK: view image

Paralogs for CTSK Gene

Paralogs for CTSK Gene

(8) SIMAP similar genes for CTSK Gene using alignment to 5 proteins:

  • CATK_HUMAN
  • H7CEH5_HUMAN
  • Q2XNE6_HUMAN
  • Q5QP40_HUMAN
  • Q6FHN2_HUMAN
genes like me logo Genes that share paralogs with CTSK: view

Variants for CTSK Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for CTSK Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1057516514 likely-pathogenic, Pyknodysostosis 150,804,213(-) AAAA/AAA coding_sequence_variant, frameshift
rs1057516587 likely-pathogenic, Pyknodysostosis 150,806,226(-) T/C splice_acceptor_variant
rs1057516627 likely-pathogenic, Pyknodysostosis 150,804,189(-) GCCCTCCAGGGCACCCACAGAGCTAAAAGCCC/GCCC coding_sequence_variant, frameshift
rs1057516725 likely-pathogenic, Pyknodysostosis 150,805,865(-) TTTTT/TTTTTT coding_sequence_variant, frameshift
rs1057516790 likely-pathogenic, Pyknodysostosis 150,806,758(-) C/ coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for CTSK Gene

Variant ID Type Subtype PubMed ID
nsv160180 CNV deletion 16902084
nsv2788 CNV deletion 18451855
nsv2799 CNV insertion 18451855
nsv437169 CNV loss 16327808

Variation tolerance for CTSK Gene

Residual Variation Intolerance Score: 40.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.57; 12.34% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CTSK Gene

Human Gene Mutation Database (HGMD)
CTSK
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CTSK

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CTSK Gene

Disorders for CTSK Gene

MalaCards: The human disease database

(24) MalaCards diseases for CTSK Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
pycnodysostosis
  • pyknodysostosis; pknd
endosteal hyperostosis, autosomal dominant
  • hyperostosis corticalis generalisata, benign form of worth, with torus palatinus
hypersensitivity pneumonitis, familial
  • bird fancier's lung
bone giant cell tumor
  • giant cell myeloma
bone disease
  • skeletal disease
- elite association - COSMIC cancer census association via MalaCards
Search CTSK in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CATK_HUMAN
  • Pycnodysostosis (PKND) [MIM:265800]: A rare autosomal recessive bone disorder characterized by deformity of the skull, maxilla and phalanges, osteosclerosis, and fragility of bone. {ECO:0000269 PubMed:10491211, ECO:0000269 PubMed:10878663, ECO:0000269 PubMed:22822386, ECO:0000269 PubMed:25731711, ECO:0000269 PubMed:8703060, ECO:0000269 PubMed:9529353}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for CTSK

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CTSK: view

No data available for Genatlas for CTSK Gene

Publications for CTSK Gene

  1. Molecular cloning of human cDNA for cathepsin K: novel cysteine proteinase predominantly expressed in bone. (PMID: 7818555) Inaoka T … Kokubo T (Biochemical and biophysical research communications 1995) 2 3 4 22 58
  2. Characterization of common genetic variants in cathepsin K and testing for association with bone mineral density in a large cohort of perimenopausal women from Scotland. (PMID: 14753734) Giraudeau FS … Wood J (Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 2004) 3 22 44 58
  3. Crystal structure of wild-type human procathepsin K. (PMID: 10048321) Sivaraman J … Cygler M (Protein science : a publication of the Protein Society 1999) 3 4 22 58
  4. The crystal structure of human procathepsin K. (PMID: 9893980) LaLonde JM … Smith WW (Biochemistry 1999) 3 4 22 58
  5. Design of potent and selective human cathepsin K inhibitors that span the active site. (PMID: 9405598) Thompson SK … Veber DF (Proceedings of the National Academy of Sciences of the United States of America 1997) 3 4 22 58

Products for CTSK Gene