Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CREBL2 Gene

Aliases for CREBL2 Gene

  • CAMP Responsive Element Binding Protein Like 2 2 3 5
  • CAMP Responsive Element Binding Protein-Like 2 2

External Ids for CREBL2 Gene

Previous GeneCards Identifiers for CREBL2 Gene

  • GC12P012491
  • GC12P012909
  • GC12P012665
  • GC12P012656
  • GC12P012764
  • GC12P012529

Summaries for CREBL2 Gene

Entrez Gene Summary for CREBL2 Gene

  • cAMP response element (CRE)-binding protein-like-2 (CREBL2) was identified in a search to find genes in a commonly deleted region on chromosome 12p13 flanked by ETV6 and CDKN1B genes, frequently associated with hematopoietic malignancies, as well as breast, non-small-cell lung and ovarian cancers. CREBL2 shares a 41% identity with CRE-binding protein (CREB) over a 48-base long region which encodes the bZip domain of CREB. The bZip domain consists of about 30 amino acids rich in basic residues involved in DNA binding, followed by a leucine zipper motif involved in protein dimerization. This suggests that CREBL2 encodes a protein with DNA binding capabilities. The occurance of CREBL2 deletion in malignancy suggests that CREBL2 may act as a tumor suppressor gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for CREBL2 Gene

CREBL2 (CAMP Responsive Element Binding Protein Like 2) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and sequence-specific DNA binding.

UniProtKB/Swiss-Prot for CREBL2 Gene

  • Probable regulator of CREB1 transcriptional activity which is involved in adipose cells differentiation. May also play a regulatory role in the cell cycle. Identification in a chromosomal region frequently deleted in various cancers suggests that it might act as a tumor suppressor.

Additional gene information for CREBL2 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CREBL2 Gene

Genomics for CREBL2 Gene

GeneHancer (GH) Regulatory Elements for CREBL2 Gene

Promoters and enhancers for CREBL2 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I012610 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 558.9 +0.4 446 3.2 PKNOX1 FOXA2 SMAD1 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 CREBL2 DUSP16 RPL21P136
GH12I012557 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.4 -50.7 -50712 7 PKNOX1 FOXA2 SMAD1 ARID4B SIN3A FEZF1 DMAP1 ZNF2 IRF4 YY1 DUSP16 CREBL2 GPR19 CDKN1B ENSG00000255670 BCL2L14 GC12M012561 PIR41199
GH12I012402 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 11.1 -207.1 -207051 5.3 PKNOX1 ATF1 FOXA2 ARID4B FEZF1 DMAP1 YY1 SLC30A9 ATF7 RXRA CDKN1B CREBL2 DUSP16 ENSG00000240424 GPR19 BORCS5 GPRC5D-AS1 GC12M012364 GC12P012409
GH12I012448 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 10.8 -161.5 -161526 3 PKNOX1 FOXA2 MLX ARID4B DMAP1 ETS1 YY1 SLC30A9 ATF7 RXRA GC12P012450 DUSP16 CREBL2 ENSG00000240424 GPR19 BORCS5 BCL2L14 ENSG00000271370
GH12I012439 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 10.7 -169.8 -169849 5.9 PKNOX1 FOXA2 ARID4B YY1 SLC30A9 TCF12 ZNF207 FOS RUNX3 RXRA BORCS5 DUSP16 DDX47 ENSG00000240424 CDKN1B CREBL2 APOLD1 BCL2L14 GPR19 GC12P012450
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CREBL2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CREBL2 gene promoter:

Genomic Locations for CREBL2 Gene

Genomic Locations for CREBL2 Gene
chr12:12,611,827-12,645,108
(GRCh38/hg38)
Size:
33,282 bases
Orientation:
Plus strand
chr12:12,764,761-12,798,042
(GRCh37/hg19)

Genomic View for CREBL2 Gene

Genes around CREBL2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CREBL2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CREBL2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CREBL2 Gene

Proteins for CREBL2 Gene

  • Protein details for CREBL2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O60519-CRBL2_HUMAN
    Recommended name:
    cAMP-responsive element-binding protein-like 2
    Protein Accession:
    O60519
    Secondary Accessions:
    • B5BUM5

    Protein attributes for CREBL2 Gene

    Size:
    120 amino acids
    Molecular mass:
    13784 Da
    Quaternary structure:
    • Interacts with CREB1; regulates CREB1 phosphorylation, stability and transcriptional activity.

neXtProt entry for CREBL2 Gene

Post-translational modifications for CREBL2 Gene

Other Protein References for CREBL2 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for CREBL2 Gene

Domains & Families for CREBL2 Gene

Gene Families for CREBL2 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for CREBL2 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for CREBL2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

O60519

UniProtKB/Swiss-Prot:

CRBL2_HUMAN :
  • Belongs to the bZIP family. ATF subfamily.
Family:
  • Belongs to the bZIP family. ATF subfamily.
genes like me logo Genes that share domains with CREBL2: view

Function for CREBL2 Gene

Molecular function for CREBL2 Gene

GENATLAS Biochemistry:
cAMP response element binding protein-like 2
UniProtKB/Swiss-Prot Function:
Probable regulator of CREB1 transcriptional activity which is involved in adipose cells differentiation. May also play a regulatory role in the cell cycle. Identification in a chromosomal region frequently deleted in various cancers suggests that it might act as a tumor suppressor.

Phenotypes From GWAS Catalog for CREBL2 Gene

Gene Ontology (GO) - Molecular Function for CREBL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA --
GO:0003700 DNA binding transcription factor activity IEA,TAS --
genes like me logo Genes that share ontologies with CREBL2: view
genes like me logo Genes that share phenotypes with CREBL2: view

Animal Model Products

miRNA for CREBL2 Gene

miRTarBase miRNAs that target CREBL2

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CREBL2 Gene

Localization for CREBL2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CREBL2 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CREBL2 gene
Compartment Confidence
nucleus 5
cytosol 3
mitochondrion 2
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Mitochondria (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for CREBL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus TAS,ISS --
genes like me logo Genes that share ontologies with CREBL2: view

Pathways & Interactions for CREBL2 Gene

SuperPathways for CREBL2 Gene

No Data Available

Interacting Proteins for CREBL2 Gene

Gene Ontology (GO) - Biological Process for CREBL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated TAS,IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007049 cell cycle IEA --
GO:0007165 signal transduction TAS 9693048
GO:0030154 cell differentiation IEA --
genes like me logo Genes that share ontologies with CREBL2: view

No data available for Pathways by source and SIGNOR curated interactions for CREBL2 Gene

Drugs & Compounds for CREBL2 Gene

No Compound Related Data Available

Transcripts for CREBL2 Gene

mRNA/cDNA for CREBL2 Gene

Unigene Clusters for CREBL2 Gene

CAMP responsive element binding protein-like 2:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CREBL2 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5
SP1: -
SP2:

Relevant External Links for CREBL2 Gene

GeneLoc Exon Structure for
CREBL2
ECgene alternative splicing isoforms for
CREBL2

Expression for CREBL2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CREBL2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for CREBL2 Gene

This gene is overexpressed in Ovary (43.7) and CD4 Tcells (25.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for CREBL2 Gene



Protein tissue co-expression partners for CREBL2 Gene

NURSA nuclear receptor signaling pathways regulating expression of CREBL2 Gene:

CREBL2

SOURCE GeneReport for Unigene cluster for CREBL2 Gene:

Hs.591156

Evidence on tissue expression from TISSUES for CREBL2 Gene

  • Nervous system(4.7)
  • Skin(4.2)
  • Bone marrow(4.1)
  • Lung(2)
genes like me logo Genes that share expression patterns with CREBL2: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CREBL2 Gene

Orthologs for CREBL2 Gene

This gene was present in the common ancestor of animals.

Orthologs for CREBL2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CREBL2 33 34
  • 99.72 (n)
oppossum
(Monodelphis domestica)
Mammalia -- 34
  • 95 (a)
OneToMany
-- 34
  • 79 (a)
OneToMany
dog
(Canis familiaris)
Mammalia CREBL2 33 34
  • 94.17 (n)
cow
(Bos Taurus)
Mammalia CREBL2 33 34
  • 92.5 (n)
rat
(Rattus norvegicus)
Mammalia Crebl2 33
  • 91.04 (n)
mouse
(Mus musculus)
Mammalia Crebl2 33 16 34
  • 89.64 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia CREBL2 34
  • 79 (a)
OneToOne
chicken
(Gallus gallus)
Aves CREBL2 33 34
  • 82.91 (n)
lizard
(Anolis carolinensis)
Reptilia CREBL2 34
  • 88 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia crebl2 33
  • 73.51 (n)
zebrafish
(Danio rerio)
Actinopterygii crebl2 33 34
  • 72.65 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG18619 33 34
  • 60.49 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP008762 33
  • 59.67 (n)
Species where no ortholog for CREBL2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CREBL2 Gene

ENSEMBL:
Gene Tree for CREBL2 (if available)
TreeFam:
Gene Tree for CREBL2 (if available)

Paralogs for CREBL2 Gene

No data available for Paralogs for CREBL2 Gene

Variants for CREBL2 Gene

Sequence variations from dbSNP and Humsavar for CREBL2 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs1000077504 -- 12,638,569(+) A/G intron_variant
rs1000108897 -- 12,612,996(+) C/T intron_variant
rs1000142746 -- 12,620,651(+) TTAATCTAAGTTTAATCTAAGTTTAA/TTAATCTAAGTTTAA intron_variant
rs1000199362 -- 12,640,225(+) C/T intron_variant
rs1000349895 -- 12,632,158(+) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for CREBL2 Gene

Variant ID Type Subtype PubMed ID
nsv975453 CNV duplication 23825009
nsv612 CNV insertion 18451855
nsv509456 CNV insertion 20534489
nsv475559 CNV novel sequence insertion 20440878
nsv1046355 CNV loss 25217958
esv2759880 CNV gain 17122850
esv2745567 CNV deletion 23290073

Variation tolerance for CREBL2 Gene

Residual Variation Intolerance Score: 56.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.07; 1.60% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CREBL2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CREBL2

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CREBL2 Gene

Disorders for CREBL2 Gene

Additional Disease Information for CREBL2

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for CREBL2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CREBL2 Gene

Publications for CREBL2 Gene

  1. CREBL2, a novel transcript from the chromosome 12 region flanked by ETV6 and CDKN1B. (PMID: 9693048) Hoornaert I … Baens M (Genomics 1998) 2 3 4 58
  2. DNMT3L interacts with transcription factors to target DNMT3L/DNMT3B to specific DNA sequences: role of the DNMT3L/DNMT3B/p65-NFκB complex in the (de-)methylation of TRAF1. (PMID: 24952347) Pacaud R … Cartron PF (Biochimie 2014) 3 58
  3. Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (PMID: 23273568) Yang W … Lau YL (American journal of human genetics 2013) 3 58
  4. Abnormalities of the der(12)t(12;21) in ETV6-RUNX1 acute lymphoblastic leukemia. (PMID: 23077088) Al-Shehhi H … Moorman AV (Genes, chromosomes & cancer 2013) 3 58
  5. Ubiquitin-mediated proteolysis of HuR by heat shock. (PMID: 19322201) Abdelmohsen K … Gorospe M (The EMBO journal 2009) 3 58

Products for CREBL2 Gene

Sources for CREBL2 Gene

Content
Loading form....