Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CRB1 Gene

Aliases for CRB1 Gene

  • Crumbs 1, Cell Polarity Complex Component 2 3 5
  • Crumbs Family Member 1, Photoreceptor Morphogenesis Associated 2 3
  • Crumbs (Drosophila) Homolog 1 2
  • Crumbs Homolog 1 (Drosophila) 2
  • Protein Crumbs Homolog 1 3
  • LCA8 3
  • RP12 3

External Ids for CRB1 Gene

Previous HGNC Symbols for CRB1 Gene

  • RP12

Previous GeneCards Identifiers for CRB1 Gene

  • GC01P194964
  • GC01P192695
  • GC01P193703
  • GC01P194525
  • GC01P193969
  • GC01P195504
  • GC01P197237
  • GC01P168395

Summaries for CRB1 Gene

Entrez Gene Summary for CRB1 Gene

  • This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]

GeneCards Summary for CRB1 Gene

CRB1 (Crumbs 1, Cell Polarity Complex Component) is a Protein Coding gene. Diseases associated with CRB1 include Retinitis Pigmentosa 12 and Leber Congenital Amaurosis 8. Among its related pathways are Notch Signaling Pathway (sino) and Sertoli-Sertoli Cell Junction Dynamics. Gene Ontology (GO) annotations related to this gene include calcium ion binding. An important paralog of this gene is CRB2.

UniProtKB/Swiss-Prot for CRB1 Gene

  • Plays a role in photoreceptor morphogenesis in the retina. May maintain cell polarization and adhesion.

Gene Wiki entry for CRB1 Gene

Additional gene information for CRB1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CRB1 Gene

Genomics for CRB1 Gene

GeneHancer (GH) Regulatory Elements for CRB1 Gene

Promoters and enhancers for CRB1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01J197198 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 650.7 -1.2 -1161 4.6 SMAD1 ARNT ZFP64 ARID4B NEUROD1 SIN3A DMAP1 ZNF2 IRF4 YY1 ZBTB41 GC01P197201 CRB1 CFHR3 ASPM
GH01J197441 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 650.1 +240.7 240744 0.9 ATF1 FOXA2 BRCA1 RFX5 YY1 TCF12 ZNF766 RCOR1 RXRA CEBPB CRB1 ENSG00000230260 GC01P197383
GH01J197268 Promoter 0.6 EPDnew 661.7 +66.8 66778 0.1 SP1 CRB1 ZBTB41 LOC127011 MRPS21P3
GH01J197173 Enhancer 0.9 ENCODE 11.4 -27.2 -27230 1.7 FOXA2 MLX ARID4B DMAP1 YY1 NFKBIZ RXRA MXD4 PPARG KAT8 ASPM ZBTB41 CRB1 CFHR3 GC01P197135
GH01J197178 Enhancer 0.7 ENCODE 11.4 -22.3 -22338 0.9 CTCF MEIS2 PKNOX1 NFATC3 SIN3A BACH1 BATF RAD21 ZNF316 NCOR1 ASPM ZBTB41 CRB1 CFHR3 GC01P197135
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CRB1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CRB1 gene promoter:
  • RP58
  • Max1
  • c-Myc
  • MyoD
  • POU2F1a
  • POU2F1
  • Hlf
  • RORalpha1

Genomic Locations for CRB1 Gene

Genomic Locations for CRB1 Gene
chr1:197,201,462-197,478,455
(GRCh38/hg38)
Size:
276,994 bases
Orientation:
Plus strand
chr1:197,170,592-197,447,585
(GRCh37/hg19)
Size:
276,994 bases
Orientation:
Plus strand

Genomic View for CRB1 Gene

Genes around CRB1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CRB1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CRB1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CRB1 Gene

Proteins for CRB1 Gene

  • Protein details for CRB1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P82279-CRUM1_HUMAN
    Recommended name:
    Protein crumbs homolog 1
    Protein Accession:
    P82279
    Secondary Accessions:
    • A2A308
    • B7Z5T2
    • B9EG71
    • Q5K3A6
    • Q5TC28
    • Q5VUT1
    • Q6N027
    • Q8WWY0
    • Q8WWY1

    Protein attributes for CRB1 Gene

    Size:
    1406 amino acids
    Molecular mass:
    154183 Da
    Quaternary structure:
    • Forms a complex with MPDZ (By similarity). Forms a complex with MPP4 and MPP5.
    SequenceCaution:
    • Sequence=CAE45845.1; Type=Erroneous termination; Positions=567; Note=Translated as Trp.; Evidence={ECO:0000305}; Sequence=CAI16644.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for CRB1 Gene

    Alternative splice isoforms for CRB1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CRB1 Gene

Post-translational modifications for CRB1 Gene

  • Extensively glycosylated.
  • Glycosylation at posLast=12731273, Asn1265, posLast=12431243, posLast=11901190, Asn1000, posLast=975975, Asn968, Asn880, Asn871, Asn757, Asn657, posLast=561561, Asn550, posLast=453453, posLast=427427, posLast=418418, posLast=322322, Asn313, Asn287, Asn215, posLast=4242, Asn41, and posLast=3030
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for CRB1 Gene

Domains & Families for CRB1 Gene

Gene Families for CRB1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins
  • Predicted membrane proteins
  • Predicted secreted proteins

Graphical View of Domain Structure for InterPro Entry

P82279

UniProtKB/Swiss-Prot:

CRUM1_HUMAN :
  • Belongs to the Crumbs protein family.
Family:
  • Belongs to the Crumbs protein family.
genes like me logo Genes that share domains with CRB1: view

Function for CRB1 Gene

Molecular function for CRB1 Gene

UniProtKB/Swiss-Prot Function:
Plays a role in photoreceptor morphogenesis in the retina. May maintain cell polarization and adhesion.
GENATLAS Biochemistry:
Drosophila crumbs homolog 1,expressed in the neural retina,fetal and adult brain,not expressed in RPE/choroid,potentially involved in the organization or polarity of retinal cells

Phenotypes From GWAS Catalog for CRB1 Gene

Gene Ontology (GO) - Molecular Function for CRB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding IEA --
GO:0005515 protein binding IPI 11927608
genes like me logo Genes that share ontologies with CRB1: view
genes like me logo Genes that share phenotypes with CRB1: view

Human Phenotype Ontology for CRB1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CRB1 Gene

MGI Knock Outs for CRB1:

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for CRB1 Gene

Localization for CRB1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CRB1 Gene

Isoform 1: Apical cell membrane; Single-pass type I membrane protein. Note=Distributed at the apical membrane of all retinal epithelial cells. Located in the apical membrane of the adherens junction in outer limiting membrane (OLM) of the retina.
Isoform 2: Secreted.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CRB1 gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytoskeleton 1
peroxisome 1
endoplasmic reticulum 1
golgi apparatus 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CRB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001917 photoreceptor inner segment IEA --
GO:0005576 extracellular region IEA --
GO:0005622 intracellular IEA --
GO:0005886 plasma membrane IEA --
GO:0005902 microvillus IEA --
genes like me logo Genes that share ontologies with CRB1: view

Pathways & Interactions for CRB1 Gene

genes like me logo Genes that share pathways with CRB1: view

Pathways by source for CRB1 Gene

1 Sino Biological pathway for CRB1 Gene
1 KEGG pathway for CRB1 Gene
1 Qiagen pathway for CRB1 Gene

Gene Ontology (GO) - Biological Process for CRB1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006611 protein export from nucleus IC --
GO:0007009 plasma membrane organization IEA --
GO:0007163 establishment or maintenance of cell polarity TAS 10508521
GO:0007267 cell-cell signaling TAS 10508521
GO:0042462 eye photoreceptor cell development IEA --
genes like me logo Genes that share ontologies with CRB1: view

No data available for SIGNOR curated interactions for CRB1 Gene

Drugs & Compounds for CRB1 Gene

(1) Additional Compounds for CRB1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with CRB1: view

Transcripts for CRB1 Gene

Unigene Clusters for CRB1 Gene

Crumbs homolog 1 (Drosophila):
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CRB1 Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12a · 12b ^ 13 ^ 14a · 14b ^ 15a · 15b · 15c
SP1: - - - - - - -
SP2: - - - -
SP3: - - - - - - - - -
SP4:
SP5:
SP6: - -
SP7: -
SP8: -

Relevant External Links for CRB1 Gene

GeneLoc Exon Structure for
CRB1
ECgene alternative splicing isoforms for
CRB1

Expression for CRB1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CRB1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CRB1 Gene

This gene is overexpressed in Brain - Cerebellum (x5.1), Brain - Caudate (basal ganglia) (x5.0), Brain - Cerebellar Hemisphere (x4.9), Brain - Amygdala (x4.7), and Brain - Nucleus accumbens (basal ganglia) (x4.4).

Protein differential expression in normal tissues from HIPED for CRB1 Gene

This gene is overexpressed in Urine (37.3), Serum (18.7), and Plasma (9.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CRB1 Gene



Protein tissue co-expression partners for CRB1 Gene

NURSA nuclear receptor signaling pathways regulating expression of CRB1 Gene:

CRB1

SOURCE GeneReport for Unigene cluster for CRB1 Gene:

Hs.126135

mRNA Expression by UniProt/SwissProt for CRB1 Gene:

P82279-CRUM1_HUMAN
Tissue specificity: Preferential expression in retina, also expressed in brain, testis, fetal brain and fetal eye.

Evidence on tissue expression from TISSUES for CRB1 Gene

  • Nervous system(4.7)
  • Eye(4.6)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CRB1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • head
  • middle ear
  • nose
  • olfactory bulb
  • outer ear
  • skull
Abdomen:
  • liver
Pelvis:
  • penis
  • testicle
General:
  • blood
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal cord
genes like me logo Genes that share expression patterns with CRB1: view

Orthologs for CRB1 Gene

This gene was present in the common ancestor of animals.

Orthologs for CRB1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CRB1 34 33
  • 99.29 (n)
OneToOne
dog
(Canis familiaris)
Mammalia CRB1 34 33
  • 86.69 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Crb1 16 34 33
  • 82.33 (n)
rat
(Rattus norvegicus)
Mammalia Crb1 33
  • 81.14 (n)
cow
(Bos Taurus)
Mammalia CRB1 34 33
  • 77.12 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CRB1 34
  • 68 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia CRB1 34
  • 67 (a)
OneToOne
chicken
(Gallus gallus)
Aves CRB1 34 33
  • 68.73 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia CRB1 34
  • 61 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia crb1 33
  • 56.91 (n)
zebrafish
(Danio rerio)
Actinopterygii crb1 34 33
  • 52.91 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG15388 35
  • 43 (a)
crb 35
  • 30 (a)
eys 34
  • 14 (a)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea W02C12.1 35
  • 37 (a)
Y69H2.12 35
  • 28 (a)
crb-1 35
  • 26 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 42 (a)
OneToOne
Species where no ortholog for CRB1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CRB1 Gene

ENSEMBL:
Gene Tree for CRB1 (if available)
TreeFam:
Gene Tree for CRB1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CRB1: view image

Paralogs for CRB1 Gene

Paralogs for CRB1 Gene

(9) SIMAP similar genes for CRB1 Gene using alignment to 5 proteins:

  • CRUM1_HUMAN
  • B7Z824_HUMAN
  • F5H0L2_HUMAN
  • F5H1K8_HUMAN
  • L8E9V4_HUMAN
genes like me logo Genes that share paralogs with CRB1: view

Variants for CRB1 Gene

Sequence variations from dbSNP and Humsavar for CRB1 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1002995556 uncertain-significance, Retinitis Pigmentosa, Recessive, Leber congenital amaurosis, Pigmented paravenous chorioretinal atrophy 197,268,218(+) G/A 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, non_coding_transcript_variant, upstream_transcript_variant
rs1005259007 likely-benign, likely-pathogenic, not specified, Macular dystrophy 197,328,844(+) GATGGAATTGATGG/GATGG/GATGGAATTGATGGAATTGATGG 5_prime_UTR_variant, coding_sequence_variant, genic_upstream_transcript_variant, inframe_deletion, inframe_insertion, non_coding_transcript_variant
rs113082791 Leber congenital amaurosis 8 (LCA8) [MIM:613835] 197,421,432(+) T/C coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs114052315 likely-benign, uncertain-significance, Retinitis Pigmentosa, Recessive, Pigmented paravenous chorioretinal atrophy, Leber congenital amaurosis, Leber congenital amaurosis 8 197,429,486(+) G/A coding_sequence_variant, intron_variant, missense_variant, non_coding_transcript_variant
rs114342808 pathogenic, Leber congenital amaurosis 8, Retinitis pigmentosa 12 197,421,404(+) C/T coding_sequence_variant, non_coding_transcript_variant, stop_gained

Structural Variations from Database of Genomic Variants (DGV) for CRB1 Gene

Variant ID Type Subtype PubMed ID
dgv73e214 CNV loss 21293372
esv2669387 CNV deletion 23128226
esv2677550 CNV deletion 23128226
esv2721062 CNV deletion 23290073
esv3588492 CNV loss 21293372
esv3588493 CNV loss 21293372
esv3588494 CNV loss 21293372
esv3588495 CNV loss 21293372
esv3588496 CNV loss 21293372
esv3588499 CNV loss 21293372
nsv1068409 CNV deletion 25765185
nsv1137836 CNV deletion 24896259
nsv1137837 CNV deletion 24896259
nsv477752 CNV novel sequence insertion 20440878
nsv528460 CNV gain 19592680

Variation tolerance for CRB1 Gene

Residual Variation Intolerance Score: 14.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.56; 44.48% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CRB1 Gene

Human Gene Mutation Database (HGMD)
CRB1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CRB1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CRB1 Gene

Disorders for CRB1 Gene

MalaCards: The human disease database

(22) MalaCards diseases for CRB1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search CRB1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CRUM1_HUMAN
  • Note=CRB1 mutations have been found in various retinal dystrophies, chronic and disabling disorders of visual function. They predominantly involve the posterior portion of the ocular fundus, due to degeneration in the sensory layer of the retina, retinal pigment epithelium, Bruch membrane, choroid, or a combination of these tissues. Onset of inherited retinal dystrophies is painless, bilateral and typically progressive. Most people experience gradual peripheral vision loss or tunnel vision, and difficulties with poor illumination and night vision. Central vision is usually unaffected, so the person may still be able to read. However, it can also deteriorate to cause total blindness. Examples of retinal dystrophies are retinitis pigmentosa, Leber congenital amaurosis, cone-rod dystrophy among others. {ECO:0000269 PubMed:20683928, ECO:0000269 PubMed:22065545, ECO:0000269 PubMed:28819299}.
  • Retinitis pigmentosa 12 (RP12) [MIM:600105]: A retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. RP12 is an autosomal recessive, severe form often manifesting in early childhood. Patients experiment progressive visual field loss with severe visual impairment before the age of twenty. Some patients have a preserved paraarteriolar retinal pigment epithelium (PPRPE) and hypermetropia. {ECO:0000269 PubMed:10508521, ECO:0000269 PubMed:11389483, ECO:0000269 PubMed:11559858, ECO:0000269 PubMed:12573663, ECO:0000269 PubMed:12843338, ECO:0000269 PubMed:15459956, ECO:0000269 PubMed:19140180, ECO:0000269 PubMed:19956407, ECO:0000269 PubMed:20591486, ECO:0000269 PubMed:20956273, ECO:0000269 PubMed:21987686, ECO:0000269 PubMed:22065545, ECO:0000269 PubMed:22128245, ECO:0000269 PubMed:22334370, ECO:0000269 PubMed:28819299}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Leber congenital amaurosis 8 (LCA8) [MIM:613835]: A severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. {ECO:0000269 PubMed:11231775, ECO:0000269 PubMed:11389483, ECO:0000269 PubMed:12567265, ECO:0000269 PubMed:12573663, ECO:0000269 PubMed:12700176, ECO:0000269 PubMed:12843338, ECO:0000269 PubMed:15024725, ECO:0000269 PubMed:15459956, ECO:0000269 PubMed:15691574, ECO:0000269 PubMed:16205573, ECO:0000269 PubMed:16936081, ECO:0000269 PubMed:17128490, ECO:0000269 PubMed:17438615, ECO:0000269 PubMed:17724218, ECO:0000269 PubMed:18055821, ECO:0000269 PubMed:18682808, ECO:0000269 PubMed:20108431, ECO:0000269 PubMed:20956273, ECO:0000269 PubMed:21602930, ECO:0000269 PubMed:28819299}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Pigmented paravenous chorioretinal atrophy (PPCRA) [MIM:172870]: Unusual retinal degeneration characterized by accumulation of pigmentation along retinal veins. PPCRA is dominantly inherited, but exhibited variable expressivity. Males are more likely to exhibit a severe phenotype, whereas females may remain virtually asymptomatic even in later years. The PPCRA phenotype is associated with a mutation in CRB1 gene which is likely to affect the structure of the CRB1 protein. {ECO:0000269 PubMed:15623792}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for CRB1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CRB1: view

No data available for Genatlas for CRB1 Gene

Publications for CRB1 Gene

  1. Clinical and molecular genetics of Leber's congenital amaurosis: a multicenter study of Italian patients. (PMID: 17724218) Simonelli F … Banfi S (Investigative ophthalmology & visual science 2007) 3 4 22 44 58
  2. Mutations in the CRB1 gene cause Leber congenital amaurosis. (PMID: 11231775) Lotery AJ … Stone EM (Archives of ophthalmology (Chicago, Ill. : 1960) 2001) 3 4 22 44 58
  3. Development of a diagnostic genetic test for simplex and autosomal recessive retinitis pigmentosa. (PMID: 20591486) Clark GR … Simpson DA (Ophthalmology 2010) 3 4 44 58
  4. MPP5 recruits MPP4 to the CRB1 complex in photoreceptors. (PMID: 15914641) Kantardzhieva A … Wijnholds J (Investigative ophthalmology & visual science 2005) 3 4 22 58
  5. Pigmented paravenous chorioretinal atrophy is associated with a mutation within the crumbs homolog 1 (CRB1) gene. (PMID: 15623792) McKay GJ … Silvestri G (Investigative ophthalmology & visual science 2005) 3 4 22 58

Products for CRB1 Gene

Sources for CRB1 Gene

Content
Loading form....