Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CPNE5 Gene

Aliases for CPNE5 Gene

  • Copine 5 2 3 5
  • Copine V 2 3 4
  • Copine-5 3
  • KIAA1599 4
  • COPN5 3
  • CPN5 3

External Ids for CPNE5 Gene

Previous GeneCards Identifiers for CPNE5 Gene

  • GC06M036710
  • GC06M036755
  • GC06M036816
  • GC06M036426
  • GC06M036817
  • GC06M036960
  • GC06M037037
  • GC06M037383
  • GC06M037740
  • GC06M038086

Summaries for CPNE5 Gene

Entrez Gene Summary for CPNE5 Gene

  • Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encode a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. More variants may exist, but their full-length natures could not be determined. [provided by RefSeq, Sep 2015]

GeneCards Summary for CPNE5 Gene

CPNE5 (Copine 5) is a Protein Coding gene. An important paralog of this gene is CPNE8.

UniProtKB/Swiss-Prot for CPNE5 Gene

  • Probable calcium-dependent phospholipid-binding protein that may play a role in calcium-mediated intracellular processes (By similarity). Plays a role in dendrite formation by melanocytes (PubMed:23999003).

Additional gene information for CPNE5 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CPNE5 Gene

Genomics for CPNE5 Gene

GeneHancer (GH) Regulatory Elements for CPNE5 Gene

Promoters and enhancers for CPNE5 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J036840 Promoter/Enhancer 1.8 EPDnew Ensembl dbSUPER 650.7 +0.1 101 0.6 ATF1 RB1 ZSCAN4 KLF14 ZBTB7B GLIS2 EGR1 CREM EGR2 SP3 CPNE5 C6orf89 GC06P043183
GH06J036751 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE dbSUPER 650.2 +85.0 84994 6.3 HDGF PKNOX1 RB1 ZFP64 KLF17 IRF4 ZNF335 ZNF143 ATF7 FOS CPNE5 RAB44 RNU1-88P CDKN1A ENSG00000251864 LAP3P2 MTCH1 FGD2 C6orf89 TBC1D22B
GH06J036839 Promoter/Enhancer 1.1 EPDnew dbSUPER 650.7 +0.5 538 0.1 KLF1 ZBTB6 ZNF398 ZIC2 ZBTB7B ZFHX2 ZBTB48 EGR1 PATZ1 KLF9 CPNE5 GC06P043183
GH06J036843 Enhancer 1 ENCODE dbSUPER 650.7 -0.9 -851 1.3 PKNOX1 ATF1 FOXA2 ZSCAN4 ARID4B SIN3A KLF14 ZNF48 GLIS2 CREM CPNE5 C6orf89 PPIL1 FGD2 GC06M038953
GH06J036820 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 9.7 +15.3 15320 8.8 HDGF PKNOX1 ARNT FEZF1 DMAP1 YY1 ZNF766 E2F8 FOS SP3 PPIL1 C6orf89 MTCH1 COX6A1P2 FGD2 CPNE5 MAPK14 GC06P043183
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CPNE5 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CPNE5 gene promoter:
  • HTF
  • c-Rel
  • NF-1
  • AML1a
  • aMEF-2
  • E47
  • MEF-2A
  • FOXJ2 (long isoform)
  • FOXJ2
  • GATA-1

Genomic Locations for CPNE5 Gene

Genomic Locations for CPNE5 Gene
chr6:36,740,772-36,840,002
(GRCh38/hg38)
Size:
99,231 bases
Orientation:
Minus strand
chr6:36,708,552-36,807,778
(GRCh37/hg19)
Size:
99,227 bases
Orientation:
Minus strand

Genomic View for CPNE5 Gene

Genes around CPNE5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CPNE5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CPNE5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CPNE5 Gene

Proteins for CPNE5 Gene

  • Protein details for CPNE5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9HCH3-CPNE5_HUMAN
    Recommended name:
    Copine-5
    Protein Accession:
    Q9HCH3
    Secondary Accessions:
    • Q7Z6C8

    Protein attributes for CPNE5 Gene

    Size:
    593 amino acids
    Molecular mass:
    65734 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAB13425.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for CPNE5 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CPNE5 Gene

Post-translational modifications for CPNE5 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for CPNE5 Gene

Domains & Families for CPNE5 Gene

Gene Families for CPNE5 Gene

HGNC:
Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for CPNE5 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9HCH3

UniProtKB/Swiss-Prot:

CPNE5_HUMAN :
  • Belongs to the copine family.
Family:
  • Belongs to the copine family.
genes like me logo Genes that share domains with CPNE5: view

Function for CPNE5 Gene

Molecular function for CPNE5 Gene

UniProtKB/Swiss-Prot Function:
Probable calcium-dependent phospholipid-binding protein that may play a role in calcium-mediated intracellular processes (By similarity). Plays a role in dendrite formation by melanocytes (PubMed:23999003).
GENATLAS Biochemistry:
copine 5,calcium-dependent,phospholipid binding protein,potentially involved in regulating membrane trafficking,expressed in several tissues

Phenotypes From GWAS Catalog for CPNE5 Gene

Gene Ontology (GO) - Molecular Function for CPNE5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with CPNE5: view
genes like me logo Genes that share phenotypes with CPNE5: view

Animal Models for CPNE5 Gene

MGI Knock Outs for CPNE5:
  • Cpne5 Cpne5<tm2b(EUCOMM)Hmgu>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CPNE5

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for CPNE5 Gene

Localization for CPNE5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CPNE5 Gene

Perikaryon. Cell projection.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CPNE5 gene
Compartment Confidence
extracellular 5
cytosol 4
nucleus 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CPNE5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0042995 cell projection IEA --
GO:0043005 neuron projection IEA --
GO:0043025 neuronal cell body IEA --
GO:0043204 perikaryon IEA --
GO:0070062 extracellular exosome HDA 19056867
genes like me logo Genes that share ontologies with CPNE5: view

Pathways & Interactions for CPNE5 Gene

SuperPathways for CPNE5 Gene

No Data Available

Interacting Proteins for CPNE5 Gene

Gene Ontology (GO) - Biological Process for CPNE5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0030154 cell differentiation IEA --
GO:1903861 positive regulation of dendrite extension IDA 23999003
genes like me logo Genes that share ontologies with CPNE5: view

No data available for Pathways by source and SIGNOR curated interactions for CPNE5 Gene

Drugs & Compounds for CPNE5 Gene

(1) Drugs for CPNE5 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
calcium Approved Nutra 0
genes like me logo Genes that share compounds with CPNE5: view

Transcripts for CPNE5 Gene

Unigene Clusters for CPNE5 Gene

Copine V:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CPNE5

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CPNE5 Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11a · 11b ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20a · 20b ^ 21 ^ 22 ^
SP1: - - - - -
SP2: - -
SP3: -
SP4: - -
SP5: - -
SP6:
SP7: - -
SP8:

ExUns: 23a · 23b ^ 24 ^ 25
SP1: -
SP2:
SP3:
SP4: -
SP5:
SP6:
SP7:
SP8:

Relevant External Links for CPNE5 Gene

GeneLoc Exon Structure for
CPNE5
ECgene alternative splicing isoforms for
CPNE5

Expression for CPNE5 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CPNE5 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CPNE5 Gene

This gene is overexpressed in Brain - Nucleus accumbens (basal ganglia) (x7.3), Heart - Atrial Appendage (x5.8), Brain - Putamen (basal ganglia) (x4.6), and Brain - Caudate (basal ganglia) (x4.6).

Protein differential expression in normal tissues from HIPED for CPNE5 Gene

This gene is overexpressed in Brain (28.7), Heart (25.6), and Frontal cortex (10.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CPNE5 Gene



Protein tissue co-expression partners for CPNE5 Gene

NURSA nuclear receptor signaling pathways regulating expression of CPNE5 Gene:

CPNE5

SOURCE GeneReport for Unigene cluster for CPNE5 Gene:

Hs.657869

mRNA Expression by UniProt/SwissProt for CPNE5 Gene:

Q9HCH3-CPNE5_HUMAN
Tissue specificity: Expressed in the brain, heart, stomach, spleen, lymph node and testis (PubMed:12949241). Expressed in melanocytes (PubMed:23999003).

Evidence on tissue expression from TISSUES for CPNE5 Gene

  • Nervous system(4.4)
genes like me logo Genes that share expression patterns with CPNE5: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for CPNE5 Gene

Orthologs for CPNE5 Gene

This gene was present in the common ancestor of animals.

Orthologs for CPNE5 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CPNE5 34 33
  • 99.55 (n)
OneToOne
cow
(Bos Taurus)
Mammalia CPNE5 34 33
  • 92.41 (n)
OneToOne
dog
(Canis familiaris)
Mammalia CPNE5 34 33
  • 92.3 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CPNE5 34
  • 92 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Cpne5 16 34 33
  • 89.54 (n)
rat
(Rattus norvegicus)
Mammalia Cpne5 33
  • 89.38 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia CPNE5 34
  • 82 (a)
OneToOne
chicken
(Gallus gallus)
Aves CPNE5 34
  • 79 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia CPNE5 34
  • 82 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia cpne9 33
  • 70.95 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.32366 33
zebrafish
(Danio rerio)
Actinopterygii CPNE5 (1 of 2) 34
  • 82 (a)
OneToMany
cpne5 34 33
  • 78.03 (n)
OneToMany
zgc64194 33
worm
(Caenorhabditis elegans)
Secernentea nra-1 34 33
  • 50.69 (n)
ManyToMany
gem-4 34
  • 41 (a)
ManyToMany
cpna-5 34
  • 24 (a)
ManyToMany
cpna-4 34
  • 23 (a)
ManyToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 57 (a)
OneToMany
Species where no ortholog for CPNE5 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CPNE5 Gene

ENSEMBL:
Gene Tree for CPNE5 (if available)
TreeFam:
Gene Tree for CPNE5 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CPNE5: view image

Paralogs for CPNE5 Gene

Paralogs for CPNE5 Gene

(9) SIMAP similar genes for CPNE5 Gene using alignment to 2 proteins:

  • CPNE5_HUMAN
  • Q7Z6C8_HUMAN
genes like me logo Genes that share paralogs with CPNE5: view

Variants for CPNE5 Gene

Sequence variations from dbSNP and Humsavar for CPNE5 Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs1000027565 -- 36,812,405(-) TACTGTTTAATAATAAAAAGAATATTTAC/TAC genic_upstream_transcript_variant, intron_variant
rs1000029634 -- 36,765,821(-) G/A genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000044986 -- 36,759,556(-) C/G genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000074683 -- 36,759,787(-) G/A genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000081906 -- 36,839,044(-) G/A genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for CPNE5 Gene

Variant ID Type Subtype PubMed ID
nsv819609 CNV loss 19587683
nsv818413 CNV loss 17921354
nsv602951 CNV loss 21841781
nsv602950 CNV loss 21841781
nsv5262 CNV deletion 18451855
nsv5261 CNV deletion 18451855
nsv524053 CNV loss 19592680
nsv1015689 CNV gain 25217958
esv991181 CNV deletion 20482838
esv3608712 CNV loss 21293372
esv3396486 CNV duplication 20981092
esv2731931 CNV deletion 23290073
dgv379n21 CNV loss 19592680

Variation tolerance for CPNE5 Gene

Residual Variation Intolerance Score: 36.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.50; 29.28% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CPNE5 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CPNE5

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CPNE5 Gene

Disorders for CPNE5 Gene

Additional Disease Information for CPNE5

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for CPNE5 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CPNE5 Gene

Publications for CPNE5 Gene

  1. SYT14L, especially its C2 domain, is involved in regulating melanocyte differentiation. (PMID: 23999003) Yoo JC … Yoon TJ (Journal of dermatological science 2013) 3 4 58
  2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  3. The DNA sequence and analysis of human chromosome 6. (PMID: 14574404) Mungall AJ … Beck S (Nature 2003) 3 4 58
  4. Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PMID: 10997877) Nagase T … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 2000) 3 4 58
  5. The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from Paramecium to humans. (PMID: 9430674) Creutz CE … Cohen J (The Journal of biological chemistry 1998) 2 3 58

Products for CPNE5 Gene

Sources for CPNE5 Gene

Content
Loading form....