Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CFAP65 Gene

Aliases for CFAP65 Gene

  • Cilia And Flagella Associated Protein 65 2 3 5
  • Coiled-Coil Domain Containing 108 2 3
  • CCDC108 3 4
  • Cilia- And Flagella-Associated Protein 65 3
  • Coiled-Coil Domain-Containing Protein 108 4

External Ids for CFAP65 Gene

Previous HGNC Symbols for CFAP65 Gene

  • CCDC108

Summaries for CFAP65 Gene

Entrez Gene Summary for CFAP65 Gene

  • The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

GeneCards Summary for CFAP65 Gene

CFAP65 (Cilia And Flagella Associated Protein 65) is a Protein Coding gene.

UniProtKB/Swiss-Prot for CFAP65 Gene

  • May play a role in sperm motility.

Additional gene information for CFAP65 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CFAP65 Gene

Genomics for CFAP65 Gene

GeneHancer (GH) Regulatory Elements for CFAP65 Gene

Promoters and enhancers for CFAP65 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02J219041 Promoter/Enhancer 1.2 EPDnew Ensembl 650.7 +0.1 50 0.2 MXI1 MAX BACH1 SIN3A BMI1 YY1 ETS1 ZNF335 MTA3 CHD2 CFAP65 LOC100129175
GH02J219042 Enhancer 0.5 dbSUPER 650.7 -1.2 -1202 1.6 SP1 TFAP4 USF1 SCRT2 MIER2 HNF4A ZNF644 CFAP65 NHEJ1 IHH SLC23A3 MIR3131
GH02J219272 Enhancer 1.2 FANTOM5 Ensembl ENCODE 6.2 -232.5 -232545 3.6 SIN3A RAD21 ZNF335 GLIS2 ZNF366 FOS CEBPB ZNF398 SMARCB1 SP1 GLB1L PTPRN CFAP65 TUBA4B INHA ATG9A TUBA4A
GH02J218354 Enhancer 0.8 ENCODE 5.3 +686.4 686384 0.5 MLX ARID4B ZNF48 RARA CREM THAP11 SP5 PPARG KAT8 SP1 CATIP GC02M218355 RPL19P5 PNKD TMBIM1 AAMP SLC11A1 CFAP65 CATIP-AS2
GH02J218908 Enhancer 1.8 FANTOM5 Ensembl ENCODE dbSUPER 2.1 +132.0 131953 2.4 HDGF PKNOX1 FOXA2 MLX ARNT ZFP64 ARID4B SIN3A DMAP1 ZBTB7B CNOT9 STK36 ZNF142 USP37 AAMP OBSL1 NHEJ1 CDK5R2 ENSG00000235024 ENSG00000269068
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CFAP65 on UCSC Golden Path with GeneCards custom track

Genomic Locations for CFAP65 Gene

Genomic Locations for CFAP65 Gene
chr2:219,002,846-219,041,551
(GRCh38/hg38)
Size:
38,706 bases
Orientation:
Minus strand
chr2:219,867,568-219,906,249
(GRCh37/hg19)
Size:
38,682 bases
Orientation:
Minus strand

Genomic View for CFAP65 Gene

Genes around CFAP65 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CFAP65 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CFAP65 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CFAP65 Gene

Proteins for CFAP65 Gene

  • Protein details for CFAP65 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6ZU64-CFA65_HUMAN
    Recommended name:
    Cilia- and flagella-associated protein 65
    Protein Accession:
    Q6ZU64
    Secondary Accessions:
    • A2BDD8
    • E9PCR1
    • E9PG25
    • E9PG72
    • Q6ZSR8
    • Q8N0T4
    • Q8NDJ3

    Protein attributes for CFAP65 Gene

    Size:
    1925 amino acids
    Molecular mass:
    217250 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAC86362.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAC86878.1; Type=Miscellaneous discrepancy; Note=Unlikely isoform. Aberrant splice sites.; Evidence={ECO:0000305};

    Alternative splice isoforms for CFAP65 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CFAP65 Gene

Post-translational modifications for CFAP65 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for CFAP65 Gene

Domains & Families for CFAP65 Gene

Gene Families for CFAP65 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted secreted proteins

Protein Domains for CFAP65 Gene

Suggested Antigen Peptide Sequences for CFAP65 Gene

Graphical View of Domain Structure for InterPro Entry

Q6ZU64

UniProtKB/Swiss-Prot:

CFA65_HUMAN :
  • Belongs to the CFAP65 family.
Family:
  • Belongs to the CFAP65 family.
genes like me logo Genes that share domains with CFAP65: view

Function for CFAP65 Gene

Molecular function for CFAP65 Gene

UniProtKB/Swiss-Prot Function:
May play a role in sperm motility.

Phenotypes From GWAS Catalog for CFAP65 Gene

Gene Ontology (GO) - Molecular Function for CFAP65 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding HDA 22658674
genes like me logo Genes that share ontologies with CFAP65: view
genes like me logo Genes that share phenotypes with CFAP65: view

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CFAP65 Gene

Localization for CFAP65 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CFAP65 Gene

Cell projection, cilium, flagellum membrane; Single-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CFAP65 gene
Compartment Confidence
plasma membrane 4
cytosol 2
extracellular 1
mitochondrion 1
peroxisome 1
nucleus 1

Gene Ontology (GO) - Cellular Components for CFAP65 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane IEA --
GO:0005929 cilium IEA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0031514 motile cilium IEA --
genes like me logo Genes that share ontologies with CFAP65: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for CFAP65 Gene

Pathways & Interactions for CFAP65 Gene

SuperPathways for CFAP65 Gene

No Data Available

Interacting Proteins for CFAP65 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
http://version10.5.string-db.org/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000340776%0d%0a9606.ENSP00000371236%0d%0a
Selected Interacting proteins: Q6ZU64-CFA65_HUMAN ENSP00000340776 for CFAP65 Gene via IID STRING UniProtKB

Gene Ontology (GO) - Biological Process for CFAP65 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for CFAP65 Gene

Drugs & Compounds for CFAP65 Gene

No Compound Related Data Available

Transcripts for CFAP65 Gene

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CFAP65 Gene

No ASD Table

Relevant External Links for CFAP65 Gene

GeneLoc Exon Structure for
CFAP65
ECgene alternative splicing isoforms for
CFAP65

Expression for CFAP65 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

NURSA nuclear receptor signaling pathways regulating expression of CFAP65 Gene:

CFAP65

Evidence on tissue expression from TISSUES for CFAP65 Gene

  • Nervous system(4.1)
genes like me logo Genes that share expression patterns with CFAP65: view

No data available for mRNA expression in normal human tissues , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CFAP65 Gene

Orthologs for CFAP65 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CFAP65 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CCDC108 34 33
  • 98.96 (n)
OneToOne
dog
(Canis familiaris)
Mammalia CCDC108 34 33
  • 83.99 (n)
OneToOne
cow
(Bos Taurus)
Mammalia CCDC108 34 33
  • 83.31 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia LOC301521 33
  • 79.06 (n)
mouse
(Mus musculus)
Mammalia Ccdc108 34 33
  • 78.21 (n)
OneToOne
Cfap65 16
oppossum
(Monodelphis domestica)
Mammalia CCDC108 34
  • 50 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia CCDC108 34
  • 45 (a)
OneToOne
chicken
(Gallus gallus)
Aves CCDC108 34 33
  • 59.01 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia CCDC108 34
  • 48 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ccdc108 33
  • 54.33 (n)
zebrafish
(Danio rerio)
Actinopterygii si:ch1073-349o24.2 33
  • 50.68 (n)
CCDC108 34
  • 36 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea CSA.5597 34
  • 36 (a)
OneToOne
Species where no ortholog for CFAP65 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CFAP65 Gene

ENSEMBL:
Gene Tree for CFAP65 (if available)
TreeFam:
Gene Tree for CFAP65 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CFAP65: view image

Paralogs for CFAP65 Gene

No data available for Paralogs for CFAP65 Gene

Variants for CFAP65 Gene

Sequence variations from dbSNP and Humsavar for CFAP65 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs193920770 uncertain-significance, Malignant tumor of prostate 219,035,422(-) A/ coding_sequence_variant, frameshift, genic_upstream_transcript_variant, intron_variant
rs1000029871 -- 219,044,292(-) A/G upstream_transcript_variant
rs1000123535 -- 219,025,697(-) G/A genic_downstream_transcript_variant, intron_variant
rs1000139032 -- 219,019,906(-) C/T genic_downstream_transcript_variant, intron_variant
rs1000239962 -- 219,029,939(-) CAGGGGCTGCTCCTGTCCCCAGGGG/CAGGGG genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for CFAP65 Gene

Variant ID Type Subtype PubMed ID
esv3594353 CNV loss 21293372
nsv476759 CNV novel sequence insertion 20440878
nsv584491 CNV loss 21841781
nsv834542 CNV gain 17160897
nsv954839 CNV deletion 24416366

Variation tolerance for CFAP65 Gene

Residual Variation Intolerance Score: 98.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 21.09; 99.22% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CFAP65 Gene

Human Gene Mutation Database (HGMD)
CFAP65
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CFAP65

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CFAP65 Gene

Disorders for CFAP65 Gene

No disorders were found for CFAP65 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CFAP65 Gene

Publications for CFAP65 Gene

  1. The Rose-comb mutation in chickens constitutes a structural rearrangement causing both altered comb morphology and defective sperm motility. (PMID: 22761584) Imsland F … Andersson L (PLoS genetics 2012) 2 3 58
  2. Panorama of ancient metazoan macromolecular complexes. (PMID: 26344197) Wan C … Emili A (Nature 2015) 3 58
  3. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T … Vidal M (Cell 2014) 3 58
  4. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. (PMID: 22658674) Castello A … Hentze MW (Cell 2012) 3 58
  5. Exome sequencing supports a de novo mutational paradigm for schizophrenia. (PMID: 21822266) Xu B … Karayiorgou M (Nature genetics 2011) 3 58

Products for CFAP65 Gene

Sources for CFAP65 Gene

Content
Loading form....