CEP63 Gene (Protein Coding)

Centrosomal Protein 63

GC03P134485
GIFtS:
41
This gene encodes a protein with six coiled-coil domains. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. Several alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008] See more...

Aliases for CEP63 Gene

Aliases for CEP63 Gene

  • Centrosomal Protein 63 2 3 5
  • Centrosomal Protein Of 63 KDa 3 4
  • Centrosomal Protein 63kDa 2 3
  • Centrosome Protein CEP63 3
  • SCKL6 3
  • Cep63 4

External Ids for CEP63 Gene

Previous GeneCards Identifiers for CEP63 Gene

  • GC03P135688
  • GC03P134204
  • GC03P131583

Summaries for CEP63 Gene

Entrez Gene Summary for CEP63 Gene

  • This gene encodes a protein with six coiled-coil domains. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. Several alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

GeneCards Summary for CEP63 Gene

CEP63 (Centrosomal Protein 63) is a Protein Coding gene. Diseases associated with CEP63 include Seckel Syndrome 6 and Primary Autosomal Recessive Microcephaly. Among its related pathways are Cell Cycle, Mitotic and Regulation of PLK1 Activity at G2/M Transition. An important paralog of this gene is DEUP1.

UniProtKB/Swiss-Prot Summary for CEP63 Gene

  • Required for normal spindle assembly. Plays a key role in mother-centriole-dependent centriole duplication; the function seems also to involve CEP152, CDK5RAP2 and WDR62 through a stepwise assembled complex at the centrosome that recruits CDK2 required for centriole duplication. Reported to be required for centrosomal recruitment of CEP152; however, this function has been questioned (PubMed:21983783, PubMed:26297806). Also recruits CDK1 to centrosomes (PubMed:21406398). Plays a role in DNA damage response. Following DNA damage, such as double-strand breaks (DSBs), is removed from centrosomes; this leads to the inactivation of spindle assembly and delay in mitotic progression (PubMed:21406398).

Gene Wiki entry for CEP63 Gene

Additional gene information for CEP63 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for CEP63 Gene

Genomics for CEP63 Gene

GeneHancer (GH) Regulatory Elements for CEP63 Gene

Promoters and enhancers for CEP63 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH03J134482 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 790.7 -0.5 -487 6 SIN3A ZBTB40 SP1 SREBF1 MLX RBPJ POLR2A TCF7L2 USF2 CREB1 ANAPC13 CEP63 lnc-AMOTL2-4 TOPBP1 RYK INHCAP MIR4788
GH03J134597 Enhancer 1 FANTOM5 Ensembl ENCODE 42 +112.5 112480 3.2 MNT FOSL2 ZIC2 RFX1 CTBP1 FOXA2 CTCF MAZ FOXA1 FOS EPHB1 lnc-EPHB1-1 ANAPC13 CEP63 lnc-KY-3
GH03J134307 Promoter/Enhancer 2.1 FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 11 -172.5 -172512 10.5 CTCF TCF7L2 NR2F6 CC2D1A RAD21 POLR2A TEAD4 SP1 ZBTB33 MAFK LINC02004 ENSG00000260633 ANAPC13 CEP63 LOC105374118 lnc-CEP63-4
GH03J134380 Enhancer 1 Ensembl ENCODE dbSUPER 10.2 -104.0 -104049 2.8 TCF7L2 MNT MYC NRF1 CTBP1 POLR2A DPF2 ZNF217 NFIB GATA3 ENSG00000260633 ANAPC13 CEP63 RYK HMGN1P9 lnc-CEP63-3 AMOTL2
GH03J134590 Enhancer 0.4 FANTOM5 Ensembl 26 +105.9 105880 1.6 ANAPC13 CEP63 KY EPHB1 lnc-EPHB1-1 lnc-KY-1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CEP63 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CEP63 gene promoter:
  • NF-1
  • SREBP-1a
  • SREBP-1b
  • SREBP-1c

Genomic Locations for CEP63 Gene

Genomic Locations for CEP63 Gene
chr3:134,485,721-134,575,017
(GRCh38/hg38)
Size:
89,297 bases
Orientation:
Plus strand
chr3:134,204,575-134,293,859
(GRCh37/hg19)
Size:
89,285 bases
Orientation:
Plus strand

Genomic View for CEP63 Gene

Genes around CEP63 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CEP63 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CEP63 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for CEP63 Gene

Proteins for CEP63 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for CEP63 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96MT8-CEP63_HUMAN
    Recommended name:
    Centrosomal protein of 63 kDa
    Protein Accession:
    Q96MT8
    Secondary Accessions:
    • D3DND8
    • D3DND9
    • D3DNE0
    • Q96CR0
    • Q9H8F5
    • Q9H8N0

    Protein attributes for CEP63 Gene

    Size:
    703 amino acids
    Molecular mass:
    81344 Da
    Quaternary structure:
    • Interacts with CEP152 and CDK1; these interactions recruit both ligands to centrosomes (PubMed:21406398). Interacts with CDK2, CDK5RAP2, WDR62, CEP90, KIAA0753/moonraker and CCDC14. CEP63, CDK5RAP2, CEP152, WDR62 are proposed to form a stepwise assembled complex at the centrosome forming a ring near parental centrioles (PubMed:21406398, PubMed:26297806).
    Miscellaneous:
    • CEP63 and DEUP1 paralogs are both involved in centriole amplification: while CEP63 mediates mother-centriole-dependent centriole duplication, DEUP1 mediates de novo centriole amplification in multiciliated cells.

    Three dimensional structures from OCA and Proteopedia for CEP63 Gene

    Alternative splice isoforms for CEP63 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CEP63 Gene

Protein Expression for CEP63 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for CEP63 Gene

  • Ubiquitination at Lys435
  • Modification sites at PhosphoSitePlus

Other Protein References for CEP63 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for CEP63 Gene

Domains & Families for CEP63 Gene

Gene Families for CEP63 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for CEP63 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for CEP63 Gene

GenScript: Design optimal peptide antigens:
  • Centrosomal protein of 63 kDa (CEP63_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96MT8

UniProtKB/Swiss-Prot:

CEP63_HUMAN :
  • Belongs to the CEP63 family.
Family:
  • Belongs to the CEP63 family.
genes like me logo Genes that share domains with CEP63: view

Function for CEP63 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for CEP63 Gene

UniProtKB/Swiss-Prot Function:
Required for normal spindle assembly. Plays a key role in mother-centriole-dependent centriole duplication; the function seems also to involve CEP152, CDK5RAP2 and WDR62 through a stepwise assembled complex at the centrosome that recruits CDK2 required for centriole duplication. Reported to be required for centrosomal recruitment of CEP152; however, this function has been questioned (PubMed:21983783, PubMed:26297806). Also recruits CDK1 to centrosomes (PubMed:21406398). Plays a role in DNA damage response. Following DNA damage, such as double-strand breaks (DSBs), is removed from centrosomes; this leads to the inactivation of spindle assembly and delay in mitotic progression (PubMed:21406398).

Phenotypes From GWAS Catalog for CEP63 Gene

Gene Ontology (GO) - Molecular Function for CEP63 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 12812986
genes like me logo Genes that share ontologies with CEP63: view
genes like me logo Genes that share phenotypes with CEP63: view

Human Phenotype Ontology for CEP63 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for CEP63 Gene

Localization for CEP63 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CEP63 Gene

Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Cytoplasm, cytoskeleton, microtubule organizing center, centrosome, centriole. Cytoplasm, cytoskeleton, microtubule organizing center, centrosome, centriolar satellite. Note=Colocalizes with CDK5RAP2, CEP152 and WDR62 in a discrete ring around the proximal end of the parental centriole. At this site, a cohesive structure is predicted to engage parental centrioles and procentrioles. {ECO:0000269 PubMed:21983783, ECO:0000269 PubMed:26297806}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CEP63 gene
Compartment Confidence
cytoskeleton 5
cytosol 4
nucleus 3
golgi apparatus 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for CEP63 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000922 spindle pole ISS --
GO:0005737 cytoplasm IEA --
GO:0005813 centrosome IDA 14654843
GO:0005814 centriole ISS,IBA --
GO:0005815 microtubule organizing center IEA --
genes like me logo Genes that share ontologies with CEP63: view

Pathways & Interactions for CEP63 Gene

genes like me logo Genes that share pathways with CEP63: view

Gene Ontology (GO) - Biological Process for CEP63 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000077 DNA damage checkpoint ISS --
GO:0000086 G2/M transition of mitotic cell cycle TAS --
GO:0006974 cellular response to DNA damage stimulus IEA --
GO:0007049 cell cycle IEA --
GO:0007099 centriole replication IBA,ISS --
genes like me logo Genes that share ontologies with CEP63: view

No data available for SIGNOR curated interactions for CEP63 Gene

Drugs & Compounds for CEP63 Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for CEP63 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for CEP63 Gene

(20) REFSEQ mRNAs :
(16) Additional mRNA sequences :
(151) Selected AceView cDNA sequences:
(17) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CEP63 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8a · 8b ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14a · 14b ^ 15 ^ 16a · 16b ^ 17a · 17b ^ 18 ^ 19
SP1: - - -
SP2: - - - - - - - -
SP3: - -
SP4: - - -
SP5: - -
SP6:
SP7: - - - - - - - - - - - - - - -
SP8:

Relevant External Links for CEP63 Gene

GeneLoc Exon Structure for
CEP63
ECgene alternative splicing isoforms for
CEP63

Expression for CEP63 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CEP63 Gene

mRNA expression in normal human tissues for CEP63 Gene
mRNA expression by GTEx for CEP63 GenemRNA expression by BioGPS for CEP63 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for CEP63 Gene

This gene is overexpressed in Ovary (39.1), Prostate (13.4), and Spleen (6.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CEP63 Gene



NURSA nuclear receptor signaling pathways regulating expression of CEP63 Gene:

CEP63

SOURCE GeneReport for Unigene cluster for CEP63 Gene:

Hs.443301

Evidence on tissue expression from TISSUES for CEP63 Gene

  • Blood(4.1)
  • Pancreas(4.1)
  • Nervous system(2.7)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CEP63 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • integumentary
  • nervous
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cerebellum
  • chin
  • cranial nerve
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
Thorax:
  • chest wall
  • clavicle
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • kidney
Pelvis:
  • pelvis
  • ureter
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with CEP63: view

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for CEP63 Gene

Orthologs for CEP63 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CEP63 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia CEP63 33 32
  • 99.53 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia CEP63 33 32
  • 90 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia CEP63 33 32
  • 88.43 (n)
 OneToOne
mouse
(Mus musculus)
 Mammalia Cep63 17 33 32
  • 83.93 (n)
rat
(Rattus norvegicus)
 Mammalia Cep63 32
  • 81.82 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia CEP63 33
  • 69 (a)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia CEP63 33
  • 62 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves CEP63 33 32
  • 63.29 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia CEP63 33
  • 46 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia LOC100494857 32
  • 54.59 (n)
African clawed frog
(Xenopus laevis)
 Amphibia Xl.6728 32
zebrafish
(Danio rerio)
 Actinopterygii cep63 32
  • 50.33 (n)
-- 32
sea squirt
(Ciona savignyi)
 Ascidiacea CSA.5362 33
  • 40 (a)
 OneToMany
Species where no ortholog for CEP63 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CEP63 Gene

ENSEMBL:
Gene Tree for CEP63 (if available)
TreeFam:
Gene Tree for CEP63 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CEP63: view image

Paralogs for CEP63 Gene

Paralogs for CEP63 Gene

(1) SIMAP similar genes for CEP63 Gene using alignment to 6 proteins:

  • CEP63_HUMAN
  • D6R9Q4_HUMAN
  • D6RAY6_HUMAN
  • H0Y900_HUMAN
  • H0YAE6_HUMAN
  • H0YAL1_HUMAN
genes like me logo Genes that share paralogs with CEP63: view

Variants for CEP63 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for CEP63 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1085307110 pathogenic, Hereditary spastic paraplegia 134,650,910(+) /ATGTCGATAGATACAGCACATGTCGATA genic_downstream_transcript_variant, intron_variant
rs1127826 benign, not specified, - 134,559,428(+) C/A/T coding_sequence_variant, intron_variant, missense_variant, non_coding_transcript_variant, stop_gained
rs1164567042 pathogenic, Seckel syndrome 6 134,507,193(+) G/A/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant, non_coding_transcript_variant, stop_gained
rs1266747910 pathogenic, Inborn genetic diseases 134,537,160(+) CC/C coding_sequence_variant, frameshift, non_coding_transcript_variant
rs140583017 uncertain-significance, not provided, not specified 134,545,698(+) A/G coding_sequence_variant, missense_variant, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for CEP63 Gene

Variant ID Type Subtype PubMed ID
dgv2605n106 CNV deletion 24896259
esv33705 CNV loss 17666407
nsv1002382 CNV gain 25217958
nsv829730 CNV loss 17160897
nsv955350 CNV deletion 24416366

Variation tolerance for CEP63 Gene

Residual Variation Intolerance Score: 85.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.82; 89.58% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CEP63 Gene

Human Gene Mutation Database (HGMD)
CEP63
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CEP63

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CEP63 Gene

Disorders for CEP63 Gene

MalaCards: The human disease database

(7) MalaCards diseases for CEP63 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search CEP63 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CEP63_HUMAN
  • Seckel syndrome 6 (SCKL6) [MIM:614728]: A rare autosomal recessive disorder characterized by proportionate dwarfism of prenatal onset associated with low birth weight, growth retardation, severe microcephaly with a bird-headed like appearance, and mental retardation. {ECO:0000269 PubMed:21983783}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for CEP63

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CEP63: view

No data available for Genatlas for CEP63 Gene

Publications for CEP63 Gene

  1. Proteomic characterization of the human centrosome by protein correlation profiling. (PMID: 14654843) Andersen JS … Mann M (Nature 2003) 2 3 4 56
  2. Centriolar satellites assemble centrosomal microcephaly proteins to recruit CDK2 and promote centriole duplication. (PMID: 26297806) Kodani A … Reiter JF (eLife 2015) 3 4 56
  3. Proximity interactions among centrosome components identify regulators of centriole duplication. (PMID: 24613305) Firat-Karalar EN … Stearns T (Current biology : CB 2014) 3 4 56
  4. The Cep63 paralogue Deup1 enables massive de novo centriole biogenesis for vertebrate multiciliogenesis. (PMID: 24240477) Zhao H … Zhu X (Nature cell biology 2013) 2 3 56
  5. Cep63 recruits Cdk1 to the centrosome: implications for regulation of mitotic entry, centrosome amplification, and genome maintenance. (PMID: 21406398) Löffler H … Krämer A (Cancer research 2011) 3 4 56

ExternalLinks

View latest publications for CEP63 gene in Mastermind

Products for CEP63 Gene

Sources for CEP63 Gene