Aliases for CDR2L Gene
Aliases for CDR2L Gene
External Ids for CDR2L Gene
- HGNC: 29999
- Entrez Gene: 30850
- Ensembl: ENSG00000109089
- UniProtKB: Q86X02
Previous GeneCards Identifiers for CDR2L Gene
- GC17P070496
- GC17P072983
- GC17P068394
Summaries for CDR2L Gene
GeneCards Summary for CDR2L Gene
CDR2L (Cerebellar Degeneration Related Protein 2 Like) is a Protein Coding gene. Diseases associated with CDR2L include Cerebellar Degeneration. An important paralog of this gene is CDR2.
No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for CDR2L Gene
Genomics for CDR2L Gene
GeneHancer (GH) Regulatory Elements for CDR2L Gene
Promoters and enhancers for CDR2L Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around CDR2L on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the CDR2L gene promoter:
-
- aMEF-2
- AREB6
- c-Rel
- CP2
- Ik-1
- LCR-F1
- MEF-2A
- Pbx1a
- Sox9
- Tal-1beta
Genomic Locations for CDR2L Gene
Genomic Locations for CDR2L Gene
- chr17:74,987,632-75,005,800
- (GRCh38/hg38)
- Size:
- 18,169 bases
- Orientation:
- Plus strand
- chr17:72,983,727-73,001,895
- (GRCh37/hg19)
- Size:
- 18,169 bases
- Orientation:
- Plus strand
Genomic View for CDR2L Gene
Genes around CDR2L on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 17q25.1 by HGNC
- 17q25.1 by Entrez Gene
- 17q25.1 by Ensembl
CDR2L Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for CDR2L Gene
Proteins for CDR2L Gene
-
Protein details for CDR2L Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q86X02-CDR2L_HUMAN
- Recommended name:
- Cerebellar degeneration-related protein 2-like
- Protein Accession:
- Q86X02
- B4DFA7
- Q15175
Protein attributes for CDR2L Gene
- Size:
- 465 amino acids
- Molecular mass:
- 53010 Da
- Quaternary structure:
- No Data Available
- SequenceCaution:
-
- Sequence=AAA91850.1; Type=Frameshift; Positions=10, 184, 268, 345; Evidence={ECO:0000305}; Sequence=AAH47534.1; Type=Erroneous initiation; Evidence={ECO:0000305};
Protein Expression for CDR2L Gene
Post-translational modifications for CDR2L Gene
Other Protein References for CDR2L Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Atlas Antibodies Anti-CDR2L Antibody
- Novus Biologicals Antibodies for CDR2L
- Invitrogen Antibodies for CDR2L (AFLGC-CDR2L)
- antibodies-online: Show 23 available CDR2L Antibodies ranked by validation data
Protein Products
- Atlas Antibodies PrEST Antigen CDR2L
-
OriGene Purified Proteins for CDR2L
- Search Origene for MassSpec and Protein Over-expression Lysates for CDR2L
- Origene Custom Protein Services for CDR2L
- Novus Biologicals proteins for CDR2L
No data available for DME Specific Peptides for CDR2L Gene
Domains & Families for CDR2L Gene
Gene Families for CDR2L Gene
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
Suggested Antigen Peptide Sequences for CDR2L Gene
- GenScript: Design optimal peptide antigens:
-
- Paraneoplastic 62 kDa antigen (CDR2L_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q86X02- Family:
-
- Belongs to the CDR2 family.
Function for CDR2L Gene
Phenotypes From GWAS Catalog for CDR2L Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005515 | protein binding | IPI | 27173435 |
Phenotypes for CDR2L Gene
- GenomeRNAi human phenotypes for CDR2L:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
- Applied Biological Materials (abm): CRISPR Clones for CDR2L - Select products 50% OFF >
- * CDR2L CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * CDR2L CRISPR applications: KO, Activation, Repression, and more - Browse All
-
OriGene CRISPR knockouts for CDR2L
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CDR2L
- genomics-online: gRNA clones - Search for available CDR2L gRNA products
- Overview of 71 available CDR2L gene related products
-
Santa Cruz Biotechnology (SCBT) CRISPR for CDR2L
miRNA for CDR2L Gene
- miRTarBase miRNAs that target CDR2L
-
- hsa-mir-877-5p (MIRT037215)
- hsa-mir-4668-5p (MIRT443460)
- hsa-mir-3613-3p (MIRT443461)
- hsa-mir-1295b-5p (MIRT737190)
- hsa-mir-4270 (MIRT743555)
- hsa-mir-4441 (MIRT744522)
- hsa-mir-4640-5p (MIRT746323)
- hsa-mir-4685-5p (MIRT746956)
- hsa-mir-4726-5p (MIRT747752)
- hsa-mir-4734 (MIRT747974)
- hsa-mir-4746-3p (MIRT748206)
- hsa-mir-541-3p (MIRT750362)
- hsa-mir-5586-5p (MIRT750997)
- hsa-mir-649 (MIRT752870)
- hsa-mir-6508-3p (MIRT752970)
- hsa-mir-654-5p (MIRT753433)
- hsa-mir-6754-5p (MIRT754697)
- hsa-mir-6760-5p (MIRT754916)
- hsa-mir-6786-5p (MIRT755918)
- hsa-mir-6837-5p (MIRT757238)
- hsa-mir-6878-5p (MIRT758198)
- hsa-mir-7113-5p (MIRT759099)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CDR2L
- Browse OriGene Inhibitory RNA Products For CDR2L
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CDR2L
- genomics-online: shRNA clones - Search for available CDR2L shRNA products
- Overview of 71 available CDR2L gene related products
Clone Products
- Applied Biological Materials (abm): Clones for CDR2L - Select products 50% OFF >
- * CDR2L as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * CDR2L tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
- Sino Biological Human cDNA Clone for CDR2L
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CDR2L
- genomics-online: cdna clones - Search for available CDR2L CDNA products
- Overview of 71 available CDR2L gene related products
- orf clones - Search for available CDR2L ORF products
- Overview of 71 available CDR2L gene related products
Cell Line Products
-
Horizon Cell Lines for CDR2L
No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CDR2L Gene
Localization for CDR2L Gene
| Compartment | Confidence |
|---|---|
| cytosol | 3 |
| nucleus | 2 |
- Cytosol (2)
No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for CDR2L Gene
Pathways & Interactions for CDR2L Gene
Interacting Proteins for CDR2L Gene
Selected Interacting proteins:
Q86X02-CDR2L_HUMAN
ENSP00000336587
for CDR2L Gene via
UniProtKB
STRING
IID
GPS-Prot Interaction Network for CDR2L
No data available for Pathways by source and SIGNOR curated interactions for CDR2L Gene
Drugs & Compounds for CDR2L Gene
No Compound Related Data Available
Drug Products
- Atlas Antibodies PrEST Antigen CDR2L
Transcripts for CDR2L Gene
mRNA/cDNA for CDR2L Gene
- (1) REFSEQ mRNAs :
- (6) Additional mRNA sequences :
- (90) Selected AceView cDNA sequences:
- (1) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000337231 3536 bps (ENST00000337231.5)
CRISPR Products
- Applied Biological Materials (abm): CRISPR Clones for CDR2L - Select products 50% OFF >
- * CDR2L CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * CDR2L CRISPR applications: KO, Activation, Repression, and more - Browse All
-
OriGene CRISPR knockouts for CDR2L
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CDR2L
- genomics-online: gRNA clones - Search for available CDR2L gRNA products
- Overview of 71 available CDR2L gene related products
-
Santa Cruz Biotechnology (SCBT) CRISPR for CDR2L
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CDR2L
- Browse OriGene Inhibitory RNA Products For CDR2L
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CDR2L
- genomics-online: shRNA clones - Search for available CDR2L shRNA products
- Overview of 71 available CDR2L gene related products
Clone Products
- Applied Biological Materials (abm): Clones for CDR2L - Select products 50% OFF >
- * CDR2L as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * CDR2L tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
- Sino Biological Human cDNA Clone for CDR2L
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CDR2L
- genomics-online: cdna clones - Search for available CDR2L CDNA products
- Overview of 71 available CDR2L gene related products
- orf clones - Search for available CDR2L ORF products
- Overview of 71 available CDR2L gene related products
Expression for CDR2L Gene
mRNA differential expression in normal tissues according to GTEx for CDR2L Gene
This gene is overexpressed in Brain - Cerebellum (x5.0) and Brain - Cerebellar Hemisphere (x4.4).
This gene is overexpressed in Plasma (39.2) and Heart (14.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CDR2L Gene
NURSA nuclear receptor signaling pathways regulating expression of CDR2L Gene:
CDR2LSOURCE GeneReport for Unigene cluster for CDR2L Gene:
Hs.78358Evidence on tissue expression from TISSUES for CDR2L Gene
- Nervous system(2.4)
Primer Products
-
OriGene qPCR primer pairs for CDR2L
-
OriGene qPCR primer pairs and template standards for CDR2L
- genomics-online: primer clones - Search for available CDR2L Primer products
- Overview of 71 available CDR2L gene related products
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CDR2L Gene
Orthologs for CDR2L Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | CDR2L 33 32 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | CDR2L 33 32 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | CDR2L 33 32 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Cdr2l 32 |
|
||
| mouse (Mus musculus) |
Mammalia | Cdr2l 17 33 32 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | CDR2L 33 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | CDR2L 33 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | CDR2L 33 32 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | CDR2L 33 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | cdr2l 32 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | cdr2l 33 32 |
|
OneToOne | |
| fruit fly (Drosophila melanogaster) |
Insecta | Cen 33 |
|
OneToMany |
- Species where no ortholog for CDR2L was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Evolution for CDR2L Gene
- ENSEMBL:
- Gene Tree for CDR2L (if available)
- TreeFam:
- Gene Tree for CDR2L (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for CDR2L: view image
Paralogs for CDR2L Gene
Variants for CDR2L Gene
| SNP ID | Clin | Chr 17 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1000034106 | -- | 75,000,764(+) | A/G | intron_variant | |
| rs1000064187 | -- | 74,993,810(+) | A/G | intron_variant | |
| rs1000504340 | -- | 74,987,739(+) | A/C | 5_prime_UTR_variant | |
| rs1000639773 | -- | 74,999,300(+) | ACACACACACACACACAGACACACACA/ACACACACA | intron_variant | |
| rs1000741258 | -- | 75,005,506(+) | C/G | 3_prime_UTR_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv1056788 | CNV | gain | 25217958 |
| nsv833540 | CNV | loss | 17160897 |
Gene Damage Index Score:
1.98;
36.57% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for CDR2L Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- CDR2L
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CDR2L Gene
Disorders for CDR2L Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| cerebellar degeneration |
|
|
Search CDR2L in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for CDR2L
No data available for UniProtKB/Swiss-Prot and Genatlas for CDR2L Gene
Publications for CDR2L Gene
- Genetic alterations and tumor immune attack in Yo paraneoplastic cerebellar degeneration. (PMID: 29299667) Small M … Desestret V (Acta neuropathologica 2018) 3 56
- Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 56
- Cerebellar degeneration-related proteins 2 and 2-like are present in ovarian cancer in patients with and without Yo antibodies. (PMID: 28710511) Raspotnig M … Vedeler CA (Cancer immunology, immunotherapy : CII 2017) 3 56
- An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. (PMID: 27173435) Boldt K … UK10K Rare Diseases Group (Nature communications 2016) 3 56
- The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 56
ExternalLinks
Products for CDR2L Gene
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for CDR2L
- Search Origene for MassSpec and Protein Over-expression Lysates for CDR2L
- Origene Custom Protein Services for CDR2L
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CDR2L
- Browse OriGene Inhibitory RNA Products For CDR2L
- OriGene qPCR primer pairs for CDR2L
- OriGene qPCR primer pairs and template standards for CDR2L
- OriGene CRISPR knockouts for CDR2L
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For CDR2L
- Sino Biological Human cDNA Clone for CDR2L
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for CDR2L
- Novus Biologicals proteins for CDR2L
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Invitrogen Antibodies for CDR2L (AFLGC-CDR2L)
- antibodies-online: Show 23 available CDR2L Antibodies ranked by validation data
- antibodies-online: Search results for available CDR2L related products ranked by validation data
- antibodies-online: Search results for available CDR2L related products ranked by validation data
- Horizon Cell Lines for CDR2L
- genomics-online: cdna clones - Search for available CDR2L CDNA products
- Overview of 71 available CDR2L gene related products
- orf clones - Search for available CDR2L ORF products
- Overview of 71 available CDR2L gene related products
- genomics-online: gRNA clones - Search for available CDR2L gRNA products
- Overview of 71 available CDR2L gene related products
- genomics-online: primer clones - Search for available CDR2L Primer products
- Overview of 71 available CDR2L gene related products
- genomics-online: shRNA clones - Search for available CDR2L shRNA products
- Overview of 71 available CDR2L gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CDR2L
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CDR2L
- Search GeneCopoeia for miRNA 3'UTR Target clone products for CDR2L
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CDR2L
Sources for CDR2L Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource