Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CDR2L Gene

Aliases for CDR2L Gene

  • Cerebellar Degeneration Related Protein 2 Like 2 3 5
  • Cerebellar Degeneration-Related Protein 2-Like 2 3
  • Paraneoplastic 62 KDa Antigen 3 4
  • Paraneoplastic Antigen 2 3
  • HUMPPA 3 4

External Ids for CDR2L Gene

Previous GeneCards Identifiers for CDR2L Gene

  • GC17P070496
  • GC17P072983
  • GC17P068394

Summaries for CDR2L Gene

GeneCards Summary for CDR2L Gene

CDR2L (Cerebellar Degeneration Related Protein 2 Like) is a Protein Coding gene. Diseases associated with CDR2L include Cerebellar Degeneration. An important paralog of this gene is CDR2.

Additional gene information for CDR2L Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CDR2L Gene

Genomics for CDR2L Gene

GeneHancer (GH) Regulatory Elements for CDR2L Gene

Promoters and enhancers for CDR2L Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17J074986 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 655.1 +0.6 556 2.9 HDGF ARID4B SIN3A FEZF1 ZNF213 FOS SP3 SP5 NFYC REST CDR2L HID1 KCTD2 MRPL38 ATP5PD RAB37 GC17M074998
GH17J075260 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 18.8 +274.2 274167 3 HDGF PKNOX1 SMAD1 ARNT ZFP64 SIN3A DMAP1 ZNF2 YY1 SLC30A9 GGA3 MRPS7 NUP85 NT5C UNK SAP30BP NAT9 CDR2L ENSG00000266980 TRIM65
GH17J075010 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 15 +24.6 24570 3.7 MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 MRPL58 UNK GGA3 HID1 NUP85 CDK3 NT5C ENSG00000266980 KCTD2 CDR2L
GH17J074511 Enhancer 1.8 FANTOM5 Ensembl ENCODE dbSUPER 18.8 -474.0 -474028 3.3 YBX1 FEZF1 ZNF213 ZNF416 ZNF548 SP3 ZFP41 MEF2D ZNF610 GLIS1 NUP85 NAT9 NT5C GGA3 RN7SL573P CD300E SLC16A5 MIF4GD CDR2L HID1-AS1
GH17J075455 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.2 +470.6 470611 6.4 CLOCK MLX DMAP1 YY1 SLC30A9 E2F8 ZNF143 SP3 NFYC SSRP1 TMEM94 NUP85 ENSG00000266980 UNK RECQL5 CDK3 H3F3B NT5C SLC16A5 SRP68
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CDR2L on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CDR2L gene promoter:
  • LCR-F1
  • Ik-1
  • AREB6
  • MEF-2A
  • aMEF-2
  • CP2
  • Pbx1a
  • c-Rel
  • Sox9
  • Tal-1beta

Genomic Locations for CDR2L Gene

Genomic Locations for CDR2L Gene
chr17:74,987,632-75,005,800
(GRCh38/hg38)
Size:
18,169 bases
Orientation:
Plus strand
chr17:72,983,727-73,001,895
(GRCh37/hg19)
Size:
18,169 bases
Orientation:
Plus strand

Genomic View for CDR2L Gene

Genes around CDR2L on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CDR2L Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CDR2L Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CDR2L Gene

Proteins for CDR2L Gene

  • Protein details for CDR2L Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q86X02-CDR2L_HUMAN
    Recommended name:
    Cerebellar degeneration-related protein 2-like
    Protein Accession:
    Q86X02
    Secondary Accessions:
    • B4DFA7
    • Q15175

    Protein attributes for CDR2L Gene

    Size:
    465 amino acids
    Molecular mass:
    53010 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAA91850.1; Type=Frameshift; Positions=10, 184, 268, 345; Evidence={ECO:0000305}; Sequence=AAH47534.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for CDR2L Gene

Post-translational modifications for CDR2L Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CDR2L Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for CDR2L Gene

Domains & Families for CDR2L Gene

Gene Families for CDR2L Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for CDR2L Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for CDR2L Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q86X02

UniProtKB/Swiss-Prot:

CDR2L_HUMAN :
  • Belongs to the CDR2 family.
Family:
  • Belongs to the CDR2 family.
genes like me logo Genes that share domains with CDR2L: view

Function for CDR2L Gene

Phenotypes From GWAS Catalog for CDR2L Gene

Gene Ontology (GO) - Molecular Function for CDR2L Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 27173435
genes like me logo Genes that share ontologies with CDR2L: view
genes like me logo Genes that share phenotypes with CDR2L: view

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for CDR2L Gene

Localization for CDR2L Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CDR2L gene
Compartment Confidence
cytosol 4
nucleus 3

Subcellular locations from the

Human Protein Atlas (HPA)

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for CDR2L Gene

Pathways & Interactions for CDR2L Gene

SuperPathways for CDR2L Gene

No Data Available

Gene Ontology (GO) - Biological Process for CDR2L Gene

None

No data available for Pathways by source and SIGNOR curated interactions for CDR2L Gene

Drugs & Compounds for CDR2L Gene

No Compound Related Data Available

Transcripts for CDR2L Gene

mRNA/cDNA for CDR2L Gene

(2) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(90) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CDR2L Gene

Cerebellar degeneration-related protein 2-like:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CDR2L Gene

No ASD Table

Relevant External Links for CDR2L Gene

GeneLoc Exon Structure for
CDR2L
ECgene alternative splicing isoforms for
CDR2L

Expression for CDR2L Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CDR2L Gene

mRNA differential expression in normal tissues according to GTEx for CDR2L Gene

This gene is overexpressed in Brain - Cerebellum (x5.0) and Brain - Cerebellar Hemisphere (x4.4).

Protein differential expression in normal tissues from HIPED for CDR2L Gene

This gene is overexpressed in Plasma (39.2) and Heart (14.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CDR2L Gene



Protein tissue co-expression partners for CDR2L Gene

NURSA nuclear receptor signaling pathways regulating expression of CDR2L Gene:

CDR2L

SOURCE GeneReport for Unigene cluster for CDR2L Gene:

Hs.78358

Evidence on tissue expression from TISSUES for CDR2L Gene

  • Nervous system(2.4)
genes like me logo Genes that share expression patterns with CDR2L: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CDR2L Gene

Orthologs for CDR2L Gene

This gene was present in the common ancestor of animals.

Orthologs for CDR2L Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CDR2L 34 33
  • 99.5 (n)
OneToOne
dog
(Canis familiaris)
Mammalia CDR2L 34 33
  • 91.54 (n)
OneToOne
cow
(Bos Taurus)
Mammalia CDR2L 34 33
  • 91.38 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Cdr2l 33
  • 88.6 (n)
mouse
(Mus musculus)
Mammalia Cdr2l 16 34 33
  • 88.24 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia CDR2L 34
  • 75 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CDR2L 34
  • 72 (a)
OneToOne
chicken
(Gallus gallus)
Aves CDR2L 34 33
  • 76.39 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia CDR2L 34
  • 74 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia cdr2l 33
  • 70.66 (n)
zebrafish
(Danio rerio)
Actinopterygii cdr2l 34 33
  • 67.57 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta Cen 34
  • 13 (a)
OneToMany
Species where no ortholog for CDR2L was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CDR2L Gene

ENSEMBL:
Gene Tree for CDR2L (if available)
TreeFam:
Gene Tree for CDR2L (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CDR2L: view image

Paralogs for CDR2L Gene

Paralogs for CDR2L Gene

(1) SIMAP similar genes for CDR2L Gene using alignment to 1 proteins:

  • CDR2L_HUMAN
genes like me logo Genes that share paralogs with CDR2L: view

Variants for CDR2L Gene

Sequence variations from dbSNP and Humsavar for CDR2L Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1000034106 -- 75,000,764(+) A/G intron_variant
rs1000064187 -- 74,993,810(+) A/G intron_variant
rs1000504340 -- 74,987,739(+) A/C 5_prime_UTR_variant
rs1000639773 -- 74,999,300(+) ACACACACACACACACAGACACACACA/ACACACACA intron_variant
rs1000741258 -- 75,005,506(+) C/G 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for CDR2L Gene

Variant ID Type Subtype PubMed ID
nsv1056788 CNV gain 25217958
nsv833540 CNV loss 17160897

Variation tolerance for CDR2L Gene

Gene Damage Index Score: 1.98; 36.57% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CDR2L Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CDR2L

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CDR2L Gene

Disorders for CDR2L Gene

MalaCards: The human disease database

(1) MalaCards diseases for CDR2L Gene - From: GeneCards

Disorder Aliases PubMed IDs
cerebellar degeneration
- elite association - COSMIC cancer census association via MalaCards
Search CDR2L in MalaCards View complete list of genes associated with diseases

Additional Disease Information for CDR2L

genes like me logo Genes that share disorders with CDR2L: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CDR2L Gene

Publications for CDR2L Gene

  1. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  2. Cerebellar degeneration-related proteins 2 and 2-like are present in ovarian cancer in patients with and without Yo antibodies. (PMID: 28710511) Raspotnig M … Vedeler CA (Cancer immunology, immunotherapy : CII 2017) 3 58
  3. An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. (PMID: 27173435) Boldt K … UK10K Rare Diseases Group (Nature communications 2016) 3 58
  4. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 58
  5. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein MY … Mann M (Cell 2015) 3 58

Products for CDR2L Gene

Sources for CDR2L Gene

Content
Loading form....