Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CDKN2AIPNL Gene

Aliases for CDKN2AIPNL Gene

  • CDKN2A Interacting Protein N-Terminal Like 2 3 5
  • CDKN2A-Interacting Protein N-Terminal-Like Protein 3 4
  • CDKN2AIP N-Terminal-Like Protein 3

External Ids for CDKN2AIPNL Gene

Previous GeneCards Identifiers for CDKN2AIPNL Gene

  • GC05M133756
  • GC05M128922

Summaries for CDKN2AIPNL Gene

GeneCards Summary for CDKN2AIPNL Gene

CDKN2AIPNL (CDKN2A Interacting Protein N-Terminal Like) is a Protein Coding gene. An important paralog of this gene is CDKN2AIP.

Additional gene information for CDKN2AIPNL Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CDKN2AIPNL Gene

Genomics for CDKN2AIPNL Gene

GeneHancer (GH) Regulatory Elements for CDKN2AIPNL Gene

Promoters and enhancers for CDKN2AIPNL Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J134410 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 650.7 -0.2 -188 8.5 ZFP64 DMAP1 YY1 SLC30A9 ZNF143 NFYC ZNF610 RCOR2 NBN KDM1A CDKN2AIPNL DDX46 RNU6-456P JADE2 CATSPER3 CDKL3 C5orf66 C5orf24 SKP1 RPS10P11
GH05J134521 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 11.7 -110.9 -110921 7.3 HDGF PKNOX1 CLOCK FOXA2 MLX ARID4B SIN3A FEZF1 DMAP1 ZNF2 JADE2 DDX46 ENSG00000270892 ENSG00000271128 ENSG00000248753 LOC105379188 C5orf66 RNU6-456P RPS10P11 CDKN2AIPNL
GH05J134503 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.3 -90.9 -90931 5.5 FOXA2 PKNOX1 CLOCK MLX ARID4B SIN3A DMAP1 YY1 SLC30A9 FOS LINC01843 JADE2 RPS10P11 CDKN2AIPNL ENSG00000248559 CAMLG RNU6-456P
GH05J134435 Enhancer 1.6 VISTA Ensembl ENCODE dbSUPER 12.8 -23.0 -23017 5.1 HDGF FOXA2 PKNOX1 SMAD1 ATF1 ARNT ARID4B SIN3A ZNF48 YY1 ENSG00000250994 CDKN2AIPNL JADE2 ENSG00000248559 RNU6-456P SKP1 LOC102546229 GC05P134014
GH05J134508 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 11.6 -96.2 -96221 4.6 HDGF PKNOX1 FOXA2 ZFP64 ARID4B NEUROD1 DMAP1 ZBTB7B YY1 ZNF766 C5orf24 DDX46 RPS10P11 CDKN2AIPNL ENSG00000248559 CATSPER3 SKP1 LINC01843 CAMLG RN7SL541P
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CDKN2AIPNL on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CDKN2AIPNL gene promoter:

Genomic Locations for CDKN2AIPNL Gene

Genomic Locations for CDKN2AIPNL Gene
12,539 bases
Minus strand

Genomic View for CDKN2AIPNL Gene

Genes around CDKN2AIPNL on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CDKN2AIPNL Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CDKN2AIPNL Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CDKN2AIPNL Gene

Proteins for CDKN2AIPNL Gene

  • Protein details for CDKN2AIPNL Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    CDKN2AIP N-terminal-like protein
    Protein Accession:
    Secondary Accessions:
    • Q8WVE3

    Protein attributes for CDKN2AIPNL Gene

    116 amino acids
    Molecular mass:
    13196 Da
    Quaternary structure:
    • Interacts with XRN2; the interaction is direct.

    Alternative splice isoforms for CDKN2AIPNL Gene


neXtProt entry for CDKN2AIPNL Gene

Post-translational modifications for CDKN2AIPNL Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CDKN2AIPNL Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for CDKN2AIPNL Gene

Domains & Families for CDKN2AIPNL Gene

Gene Families for CDKN2AIPNL Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for CDKN2AIPNL Gene


Suggested Antigen Peptide Sequences for CDKN2AIPNL Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the CARF family.
  • Belongs to the CARF family.
genes like me logo Genes that share domains with CDKN2AIPNL: view

Function for CDKN2AIPNL Gene

Phenotypes From GWAS Catalog for CDKN2AIPNL Gene

Gene Ontology (GO) - Molecular Function for CDKN2AIPNL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 26496610
genes like me logo Genes that share ontologies with CDKN2AIPNL: view
genes like me logo Genes that share phenotypes with CDKN2AIPNL: view

Animal Models for CDKN2AIPNL Gene

MGI Knock Outs for CDKN2AIPNL:

Animal Model Products


miRTarBase miRNAs that target CDKN2AIPNL

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for CDKN2AIPNL Gene

Localization for CDKN2AIPNL Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CDKN2AIPNL gene
Compartment Confidence
nucleus 4
cytosol 3
mitochondrion 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for CDKN2AIPNL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm IBA --
GO:0005730 nucleolus IBA --
genes like me logo Genes that share ontologies with CDKN2AIPNL: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for CDKN2AIPNL Gene

Pathways & Interactions for CDKN2AIPNL Gene

SuperPathways for CDKN2AIPNL Gene

No Data Available

Gene Ontology (GO) - Biological Process for CDKN2AIPNL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007165 signal transduction IBA --
genes like me logo Genes that share ontologies with CDKN2AIPNL: view

No data available for Pathways by source and SIGNOR curated interactions for CDKN2AIPNL Gene

Drugs & Compounds for CDKN2AIPNL Gene

No Compound Related Data Available

Transcripts for CDKN2AIPNL Gene


(82) Selected AceView cDNA sequences:
(3) Additional mRNA sequences :
(2) REFSEQ mRNAs :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CDKN2AIPNL Gene

CDKN2A interacting protein N-terminal like:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CDKN2AIPNL Gene

No ASD Table

Relevant External Links for CDKN2AIPNL Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CDKN2AIPNL Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CDKN2AIPNL Gene

Protein differential expression in normal tissues from HIPED for CDKN2AIPNL Gene

This gene is overexpressed in Peripheral blood mononuclear cells (10.7) and Monocytes (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CDKN2AIPNL Gene

NURSA nuclear receptor signaling pathways regulating expression of CDKN2AIPNL Gene:


SOURCE GeneReport for Unigene cluster for CDKN2AIPNL Gene:


Evidence on tissue expression from TISSUES for CDKN2AIPNL Gene

  • Nervous system(4.3)
  • Lung(4.1)
genes like me logo Genes that share expression patterns with CDKN2AIPNL: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CDKN2AIPNL Gene

Orthologs for CDKN2AIPNL Gene

This gene was present in the common ancestor of animals.

Orthologs for CDKN2AIPNL Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CDKN2AIPNL 34 33
  • 100 (n)
(Canis familiaris)
Mammalia CDKN2AIPNL 34 33
  • 92.24 (n)
(Bos Taurus)
Mammalia CDKN2AIPNL 34 33
  • 91.67 (n)
(Mus musculus)
Mammalia Cdkn2aipnl 16 34 33
  • 89.08 (n)
(Rattus norvegicus)
Mammalia Cdkn2aipnl 33
  • 88.51 (n)
(Monodelphis domestica)
Mammalia CDKN2AIPNL 34
  • 69 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 2 (a)
(Anolis carolinensis)
Reptilia CDKN2AIPNL 34
  • 65 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia cdkn2aipnl 33
  • 65.22 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.27136 33
(Danio rerio)
Actinopterygii cdkn2aipnl 34 33
  • 64.76 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.7108 33
fruit fly
(Drosophila melanogaster)
Insecta CG31301 34
  • 5 (a)
Species where no ortholog for CDKN2AIPNL was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CDKN2AIPNL Gene

Gene Tree for CDKN2AIPNL (if available)
Gene Tree for CDKN2AIPNL (if available)
Evolutionary constrained regions (ECRs) for CDKN2AIPNL: view image

Paralogs for CDKN2AIPNL Gene

Paralogs for CDKN2AIPNL Gene

(1) SIMAP similar genes for CDKN2AIPNL Gene using alignment to 1 proteins:

  • C2AIL_HUMAN Pseudogenes for CDKN2AIPNL Gene

genes like me logo Genes that share paralogs with CDKN2AIPNL: view

Variants for CDKN2AIPNL Gene

Sequence variations from dbSNP and Humsavar for CDKN2AIPNL Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1001308979 -- 134,412,013(-) GGCTCCTGGCTCCT/GGCTCCTGGCTCCTGGCTCCT genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1002021217 -- 134,411,500(-) G/A 3_prime_UTR_variant, intron_variant
rs1002172185 -- 134,406,509(-) G/A genic_downstream_transcript_variant, intron_variant
rs1002248581 -- 134,404,058(-) G/T genic_downstream_transcript_variant, intron_variant
rs1002321613 -- 134,413,333(-) T/C genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Variation tolerance for CDKN2AIPNL Gene

Residual Variation Intolerance Score: 45.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.19; 4.22% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CDKN2AIPNL Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for CDKN2AIPNL Gene

Disorders for CDKN2AIPNL Gene

Additional Disease Information for CDKN2AIPNL

No disorders were found for CDKN2AIPNL Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for CDKN2AIPNL Gene

Publications for CDKN2AIPNL Gene

  1. Structural basis and function of XRN2 binding by XTB domains. (PMID: 26779609) Richter H … Großhans H (Nature structural & molecular biology 2016) 3 4 58
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 58
  3. Cold-inducible RBM3 inhibits PERK phosphorylation through cooperation with NF90 to protect cells from endoplasmic reticulum stress. (PMID: 26472337) Zhu X … Wellmann S (FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2016) 3 58
  4. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein MY … Mann M (Cell 2015) 3 58
  5. TRIM65 regulates microRNA activity by ubiquitination of TNRC6. (PMID: 24778252) Li S … Dorf ME (Proceedings of the National Academy of Sciences of the United States of America 2014) 3 58

Products for CDKN2AIPNL Gene

Sources for CDKN2AIPNL Gene

Loading form....