Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CDC26 Gene

Aliases for CDC26 Gene

  • Cell Division Cycle 26 2 3 5
  • C9orf17 2 3 4
  • CDC26 Subunit Of Anaphase Promoting Complex 2 3
  • Cell Division Cycle Protein 26 Homolog 3 4
  • Anaphase-Promoting Complex Subunit 12 3 4
  • ANAPC12 3 4
  • APC12 3 4
  • Anaphase-Promoting Complex Subunit CDC26 3
  • Anaphase Promoting Complex Subunit 12 2
  • Cell Division Cycle 26 Homolog 3

External Ids for CDC26 Gene

Previous HGNC Symbols for CDC26 Gene

  • C9orf17

Previous GeneCards Identifiers for CDC26 Gene

  • GC09M106827
  • GC09M107761
  • GC09M109471
  • GC09M111405
  • GC09M113108
  • GC09M115069
  • GC09M116018
  • GC09M085636

Summaries for CDC26 Gene

Entrez Gene Summary for CDC26 Gene

  • The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Cdc26, a component of cell cycle anaphase-promoting complex (APC). APC is composed of a group of highly conserved proteins and functions as a cell cycle-regulated ubiquitin-protein ligase. APC thus is responsible for the cell cycle regulated proteolysis of various proteins. [provided by RefSeq, Jul 2008]

GeneCards Summary for CDC26 Gene

CDC26 (Cell Division Cycle 26) is a Protein Coding gene. Diseases associated with CDC26 include Retinitis Pigmentosa 70 and Pelvic Varices. Among its related pathways are Cell Cycle, Mitotic and Class I MHC mediated antigen processing and presentation.

UniProtKB/Swiss-Prot for CDC26 Gene

  • Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of Lys-11-linked polyubiquitin chains and, to a lower extent, the formation of Lys-48- and Lys-63-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.

Additional gene information for CDC26 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CDC26 Gene

Genomics for CDC26 Gene

GeneHancer (GH) Regulatory Elements for CDC26 Gene

Promoters and enhancers for CDC26 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J113274 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 687.4 +0.0 29 2.5 HDGF PKNOX1 SMAD1 MLX ARID4B SIN3A DMAP1 ZBTB7B YY1 POLR2B PRPF4 CDC26 PIR61584 GC09P114751 WDR31 FKBP15 PTBP3 SLC31A2 RGS3
GH09J113218 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE 20.9 +54.5 54513 5 HDGF PKNOX1 ARNT ARID4B SIN3A DMAP1 YBX1 ZNF2 IRF4 YY1 FKBP15 SLC31A1 PRPF4 RPL32P22 CDC26 WDR31 PTBP3 SLC31A2 SNX30 SLC46A2
GH09J113463 Promoter/Enhancer 1.6 Ensembl ENCODE dbSUPER 20.1 -188.5 -188465 1.9 ARID4B SIN3A DMAP1 ZNF2 ZNF48 GLIS2 SP3 RXRA NFYC REST C9orf43 PRPF4 CDC26 RGS3 POLE3 FKBP15 ALAD RNF183 GC09P114257
GH09J113339 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 15.1 -64.6 -64569 1.7 MLX DMAP1 IRF4 YY1 ZNF213 ZNF143 SP3 NFYC ZC3H11A ZNF610 WDR31 PRPF4 RPL32P22 CDC26 BSPRY RNF183 ALAD C9orf43 POLE3 HDHD3
GH09J113227 Enhancer 0.9 ENCODE 30 +47.3 47302 1.2 PKNOX1 ATF1 FOXA2 MLX ARID4B DMAP1 YY1 ZNF766 RXRA SP5 CDC26 PRPF4 SLC31A2 RNF183 SLC31A1 PIR39900
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CDC26 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CDC26 gene promoter:

Genomic Locations for CDC26 Gene

Genomic Locations for CDC26 Gene
19,755 bases
Minus strand

Genomic View for CDC26 Gene

Genes around CDC26 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CDC26 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CDC26 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CDC26 Gene

Proteins for CDC26 Gene

  • Protein details for CDC26 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Anaphase-promoting complex subunit CDC26
    Protein Accession:

    Protein attributes for CDC26 Gene

    85 amino acids
    Molecular mass:
    9777 Da
    Quaternary structure:
    • V-shaped homodimer. Interacts with CDC16. The mammalian APC/C is composed of 14 distinct subunits that assemble into a complex of at least 19 chains with a combined molecular mass of around 1.2 MDa.

    Three dimensional structures from OCA and Proteopedia for CDC26 Gene

neXtProt entry for CDC26 Gene

Post-translational modifications for CDC26 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CDC26 Gene

Antibody Products

  • Boster Bio Antibodies for CDC26

No data available for DME Specific Peptides for CDC26 Gene

Domains & Families for CDC26 Gene

Gene Families for CDC26 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for CDC26 Gene


Suggested Antigen Peptide Sequences for CDC26 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the CDC26 family.
  • Belongs to the CDC26 family.
genes like me logo Genes that share domains with CDC26: view

Function for CDC26 Gene

Molecular function for CDC26 Gene

UniProtKB/Swiss-Prot Function:
Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of Lys-11-linked polyubiquitin chains and, to a lower extent, the formation of Lys-48- and Lys-63-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.

Phenotypes From GWAS Catalog for CDC26 Gene

Gene Ontology (GO) - Molecular Function for CDC26 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 19668213
genes like me logo Genes that share ontologies with CDC26: view
genes like me logo Genes that share phenotypes with CDC26: view

Animal Models for CDC26 Gene

MGI Knock Outs for CDC26:
  • Cdc26 Cdc26<tm1b(EUCOMM)Hmgu>

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CDC26

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for CDC26 Gene

Localization for CDC26 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CDC26 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CDC26 gene
Compartment Confidence
nucleus 5
cytosol 5
mitochondrion 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CDC26 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005654 nucleoplasm TAS --
GO:0005680 anaphase-promoting complex IDA 10922056
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with CDC26: view

Pathways & Interactions for CDC26 Gene

SuperPathways for CDC26 Gene

SuperPathway Contained pathways
1 CDK-mediated phosphorylation and removal of Cdc6
2 APC-Cdc20 mediated degradation of Nek2A
3 Class I MHC mediated antigen processing and presentation
4 Cell Cycle, Mitotic
5 Cellular Senescence (REACTOME)
genes like me logo Genes that share pathways with CDC26: view

UniProtKB/Swiss-Prot Q8NHZ8-CDC26_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

Gene Ontology (GO) - Biological Process for CDC26 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007049 cell cycle IEA --
GO:0016567 protein ubiquitination IEA --
GO:0030071 regulation of mitotic metaphase/anaphase transition IEA --
GO:0031145 anaphase-promoting complex-dependent catabolic process TAS --
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process TAS --
genes like me logo Genes that share ontologies with CDC26: view

No data available for SIGNOR curated interactions for CDC26 Gene

Drugs & Compounds for CDC26 Gene

No Compound Related Data Available

Transcripts for CDC26 Gene

mRNA/cDNA for CDC26 Gene

Unigene Clusters for CDC26 Gene

Cell division cycle 26:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CDC26

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CDC26 Gene

No ASD Table

Relevant External Links for CDC26 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CDC26 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CDC26 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for CDC26 Gene

This gene is overexpressed in Lung (29.3), Peripheral blood mononuclear cells (9.1), and Breast (6.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CDC26 Gene

Protein tissue co-expression partners for CDC26 Gene

NURSA nuclear receptor signaling pathways regulating expression of CDC26 Gene:


SOURCE GeneReport for Unigene cluster for CDC26 Gene:


Evidence on tissue expression from TISSUES for CDC26 Gene

  • Nervous system(4.4)
  • Skin(4.1)
  • Heart(2)
  • Liver(2)
  • Spleen(2)
genes like me logo Genes that share expression patterns with CDC26: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CDC26 Gene

Orthologs for CDC26 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CDC26 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CDC26 34 33
  • 100 (n)
(Bos Taurus)
Mammalia CDC26 34 33
  • 91.76 (n)
(Canis familiaris)
Mammalia CDC26 34 33
  • 91.37 (n)
(Ornithorhynchus anatinus)
Mammalia CDC26 34
  • 89 (a)
(Rattus norvegicus)
Mammalia Cdc26 33
  • 87.45 (n)
(Mus musculus)
Mammalia Cdc26 16 34 33
  • 86.27 (n)
(Gallus gallus)
Aves CDC26 34
  • 63 (a)
(Anolis carolinensis)
Reptilia CDC26 34
  • 81 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.15762 33
(Danio rerio)
Actinopterygii cdc26 34 33
  • 66.67 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9059 33
Species where no ortholog for CDC26 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CDC26 Gene

Gene Tree for CDC26 (if available)
Gene Tree for CDC26 (if available)
Evolutionary constrained regions (ECRs) for CDC26: view image

Paralogs for CDC26 Gene

No data available for Paralogs for CDC26 Gene

Variants for CDC26 Gene

Sequence variations from dbSNP and Humsavar for CDC26 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs541873609 pathogenic, Retinitis pigmentosa 70 113,275,630(-) TGTCAGTGACGCACTTCCTGTCAGTGACGCACTTCC/TGTCAGTGACGCACTTCC upstream_transcript_variant
rs1000019573 -- 113,270,344(-) T/C intron_variant
rs1000147463 -- 113,276,459(-) T/C upstream_transcript_variant
rs1000480157 -- 113,276,111(-) C/T upstream_transcript_variant
rs1000746389 -- 113,270,846(-) A/T intron_variant

Variation tolerance for CDC26 Gene

Residual Variation Intolerance Score: 63.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.37; 8.18% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CDC26 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for CDC26 Gene

Disorders for CDC26 Gene

MalaCards: The human disease database

(3) MalaCards diseases for CDC26 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
retinitis pigmentosa 70
  • rp70
pelvic varices
retinitis pigmentosa
  • retinitis pigmentosa 1
- elite association - COSMIC cancer census association via MalaCards
Search CDC26 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for CDC26

genes like me logo Genes that share disorders with CDC26: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CDC26 Gene

Publications for CDC26 Gene

  1. The RING-H2 finger protein APC11 and the E2 enzyme UBC4 are sufficient to ubiquitinate substrates of the anaphase-promoting complex. (PMID: 10922056) Gmachl M … Peters JM (Proceedings of the National Academy of Sciences of the United States of America 2000) 2 3 4 58
  2. Molecular architecture and mechanism of the anaphase-promoting complex. (PMID: 25043029) Chang LF … Barford D (Nature 2014) 3 4 58
  3. Insights into anaphase promoting complex TPR subdomain assembly from a CDC26-APC6 structure. (PMID: 19668213) Wang J … Schulman BA (Nature structural & molecular biology 2009) 3 4 58
  4. Mechanism of ubiquitin-chain formation by the human anaphase-promoting complex. (PMID: 18485873) Jin L … Rape M (Cell 2008) 3 4 58
  5. Localization of the coactivator Cdh1 and the cullin subunit Apc2 in a cryo-electron microscopy model of vertebrate APC/C. (PMID: 16364912) Dube P … Stark H (Molecular cell 2005) 3 4 58

Products for CDC26 Gene

Sources for CDC26 Gene

Loading form....