Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CCDC66 Gene

Aliases for CCDC66 Gene

  • Coiled-Coil Domain Containing 66 2 3 5

External Ids for CCDC66 Gene

Summaries for CCDC66 Gene

GeneCards Summary for CCDC66 Gene

CCDC66 (Coiled-Coil Domain Containing 66) is a Protein Coding gene. Diseases associated with CCDC66 include Leber Congenital Amaurosis 9.

Additional gene information for CCDC66 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CCDC66 Gene

Genomics for CCDC66 Gene

GeneHancer (GH) Regulatory Elements for CCDC66 Gene

Promoters and enhancers for CCDC66 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03I056556 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 596.7 +0.3 283 2.4 HDGF SMAD1 ATF1 ARID4B SIN3A POLR2B ZNF207 ZNF143 ATF7 FOS CCDC66 FAM208A GC03P056532
GH03I056680 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 47.6 +125.3 125255 3.1 HDGF PKNOX1 SMAD1 ARNT ARID4B SIN3A DMAP1 YY1 POLR2B ZNF766 FAM208A CCDC66
GH03I056779 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 22.1 +229.1 229064 13.4 HDGF FOXA2 SMAD1 MLX ARID4B FEZF1 DMAP1 IRF4 YY1 ZNF213 CCDC66 FAM208A ARHGEF3 GC03P056724 GC03M056906
GH03I057555 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 16.8 +999.6 999649 3.4 CLOCK MLX DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 PDE12 GC03M057554 DENND6A APPL1 CCDC66 FAM208A FLNB-AS1 FLNB DENND6A-DT HESX1
GH03I056467 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE 15.7 -89.2 -89210 1.8 PKNOX1 ZNF76 SIN3A ZNF335 GLIS2 ZNF143 ZNF350 FOS ZNF680 SP3 ERC2 FAM208A CCDC66 LOC105377099
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CCDC66 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CCDC66 gene promoter:

Genomic Locations for CCDC66 Gene

Genomic Locations for CCDC66 Gene
chr3:56,557,111-56,621,836
(GRCh38/hg38)
Size:
64,726 bases
Orientation:
Plus strand
chr3:56,591,184-56,655,864
(GRCh37/hg19)

Genomic View for CCDC66 Gene

Genes around CCDC66 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CCDC66 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CCDC66 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CCDC66 Gene

Proteins for CCDC66 Gene

  • Protein details for CCDC66 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A2RUB6-CCD66_HUMAN
    Recommended name:
    Coiled-coil domain-containing protein 66
    Protein Accession:
    A2RUB6
    Secondary Accessions:
    • B3KWL8
    • Q4VC34
    • Q8N949

    Protein attributes for CCDC66 Gene

    Size:
    948 amino acids
    Molecular mass:
    109411 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAH47509.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=AAI32828.2; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=BAC04607.1; Type=Frameshift; Positions=214; Evidence={ECO:0000305};

    Alternative splice isoforms for CCDC66 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CCDC66 Gene

Post-translational modifications for CCDC66 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for CCDC66 Gene

Domains & Families for CCDC66 Gene

Gene Families for CCDC66 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for CCDC66 Gene

ProtoNet:

Suggested Antigen Peptide Sequences for CCDC66 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with CCDC66: view

No data available for UniProtKB/Swiss-Prot for CCDC66 Gene

Function for CCDC66 Gene

Phenotypes From GWAS Catalog for CCDC66 Gene

genes like me logo Genes that share phenotypes with CCDC66: view

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for CCDC66 Gene

Localization for CCDC66 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CCDC66 gene
Compartment Confidence
nucleus 3
cytosol 3
cytoskeleton 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cell Junctions (2)
  • Microtubule organizing center (2)
  • Midbody ring (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for CCDC66 Gene

Pathways & Interactions for CCDC66 Gene

SuperPathways for CCDC66 Gene

No Data Available

Gene Ontology (GO) - Biological Process for CCDC66 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for CCDC66 Gene

Drugs & Compounds for CCDC66 Gene

No Compound Related Data Available

Transcripts for CCDC66 Gene

Unigene Clusters for CCDC66 Gene

Coiled-coil domain containing 66:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CCDC66 Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f · 1g ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b ^ 7a · 7b · 7c · 7d ^ 8 ^ 9 ^ 10 ^ 11 ^ 12
SP1: - - -
SP2: - - - -
SP3: - - - - -
SP4: - - - - -
SP5:
SP6: - - - -
SP7: - -
SP8:
SP9:

Relevant External Links for CCDC66 Gene

GeneLoc Exon Structure for
CCDC66
ECgene alternative splicing isoforms for
CCDC66

Expression for CCDC66 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CCDC66 Gene

Protein differential expression in normal tissues from HIPED for CCDC66 Gene

This gene is overexpressed in Esophagus (27.4), Neutrophil (18.9), and Plasma (9.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CCDC66 Gene



NURSA nuclear receptor signaling pathways regulating expression of CCDC66 Gene:

CCDC66

SOURCE GeneReport for Unigene cluster for CCDC66 Gene:

Hs.476399
genes like me logo Genes that share expression patterns with CCDC66: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for CCDC66 Gene

Orthologs for CCDC66 Gene

This gene was present in the common ancestor of chordates.

Orthologs for CCDC66 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CCDC66 33 34
  • 99.44 (n)
dog
(Canis familiaris)
Mammalia CCDC66 33 34
  • 87.68 (n)
cow
(Bos Taurus)
Mammalia CCDC66 33 34
  • 86.6 (n)
mouse
(Mus musculus)
Mammalia Ccdc66 33 16 34
  • 79.48 (n)
rat
(Rattus norvegicus)
Mammalia Ccdc66 33
  • 77.19 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia CCDC66 34
  • 55 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CCDC66 34
  • 49 (a)
OneToOne
chicken
(Gallus gallus)
Aves CCDC66 33 34
  • 64.91 (n)
lizard
(Anolis carolinensis)
Reptilia CCDC66 34
  • 47 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ccdc66 33
  • 52.62 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC796628 33
  • 51.93 (n)
CCDC66 (1 of 2) 34
  • 33 (a)
OneToMany
CCDC66 (2 of 2) 34
  • 30 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.2586 34
  • 35 (a)
OneToOne
Species where no ortholog for CCDC66 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CCDC66 Gene

ENSEMBL:
Gene Tree for CCDC66 (if available)
TreeFam:
Gene Tree for CCDC66 (if available)

Paralogs for CCDC66 Gene

No data available for Paralogs for CCDC66 Gene

Variants for CCDC66 Gene

Sequence variations from dbSNP and Humsavar for CCDC66 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs60235683 benign, not specified 56,557,251(+) GGGGTAAGCAGGGGTAAGC/GGGGTAAGC/GGGGTAAGCAGGGGTAAGCAGGGGTAAGC/GGGGTAAGCAGGGGTAAGCAGGGGTAAGCAGGGGTAAGC 5_prime_UTR_variant, coding_sequence_variant, genic_upstream_transcript_variant, intron_variant, non_coding_transcript_variant, splice_donor_variant, upstream_transcript_variant
rs1000019575 -- 56,596,609(+) A/G intron_variant
rs1000070018 -- 56,555,283(+) T/C upstream_transcript_variant
rs1000108522 -- 56,594,700(+) C/A intron_variant
rs1000168210 -- 56,617,885(+) T/C downstream_transcript_variant, genic_downstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for CCDC66 Gene

Variant ID Type Subtype PubMed ID
dgv2526n106 CNV deletion 24896259
dgv808n67 CNV loss 20364138
esv1141708 CNV deletion 17803354
esv1966969 CNV deletion 18987734
esv21892 CNV loss 19812545
esv2555353 CNV deletion 19546169
esv2621307 CNV deletion 19546169
esv2659644 CNV deletion 23128226
esv2671315 CNV deletion 23128226
esv2678954 CNV deletion 23128226
esv2725303 CNV deletion 23290073
esv2725304 CNV deletion 23290073
esv2725305 CNV deletion 23290073
esv2725306 CNV deletion 23290073
esv2762329 CNV loss 21179565
esv3123 CNV loss 18987735
esv3561919 CNV deletion 23714750
esv3568762 CNV loss 25503493
esv3596212 CNV loss 21293372
esv3596213 CNV loss 21293372
esv3596214 CNV loss 21293372
esv3596215 CNV loss 21293372
nsv1073647 CNV deletion 25765185
nsv435762 CNV deletion 17901297
nsv460557 CNV loss 19166990
nsv528087 CNV loss 19592680
nsv590362 CNV loss 21841781
nsv820061 CNV loss 19587683
nsv956272 CNV deletion 24416366

Variation tolerance for CCDC66 Gene

Residual Variation Intolerance Score: 94.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 12.11; 93.85% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CCDC66 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CCDC66

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CCDC66 Gene

Disorders for CCDC66 Gene

MalaCards: The human disease database

(1) MalaCards diseases for CCDC66 Gene - From: DISEASES

Disorder Aliases PubMed IDs
leber congenital amaurosis 9
  • lca9
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for CCDC66

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CCDC66: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CCDC66 Gene

Publications for CCDC66 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 2 3 4 58
  2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  3. Genome-wide linkage and sequence analysis challenge CCDC66 as a human retinal dystrophy candidate gene and support a distinct NMNAT1-related fundus phenotype. (PMID: 28369829) Khan AO … Bolz HJ (Clinical genetics 2018) 3 58
  4. Noncoding Effects of Circular RNA CCDC66 Promote Colon Cancer Growth and Metastasis. (PMID: 28249903) Hsiao KY … Tsai SJ (Cancer research 2017) 3 58
  5. The centriolar satellite protein CCDC66 interacts with CEP290 and functions in cilium formation and trafficking. (PMID: 28235840) Conkar D … Firat-Karalar EN (Journal of cell science 2017) 3 58

Products for CCDC66 Gene

Sources for CCDC66 Gene

Content
Loading form....