Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CCDC151 Gene

Aliases for CCDC151 Gene

  • Coiled-Coil Domain Containing 151 2 3 5
  • Coiled-Coil Domain-Containing Protein 151 3
  • CILD30 3

External Ids for CCDC151 Gene

Previous GeneCards Identifiers for CCDC151 Gene

  • GC19M011531
  • GC19M011106

Summaries for CCDC151 Gene

Entrez Gene Summary for CCDC151 Gene

  • This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]

GeneCards Summary for CCDC151 Gene

CCDC151 (Coiled-Coil Domain Containing 151) is a Protein Coding gene. Diseases associated with CCDC151 include Ciliary Dyskinesia, Primary, 30 and Kartagener Syndrome. An important paralog of this gene is CCDC183.

UniProtKB/Swiss-Prot for CCDC151 Gene

  • Ciliary protein involved in outer dynein arm assembly and required for motile cilia function.

Additional gene information for CCDC151 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CCDC151 Gene

Genomics for CCDC151 Gene

GeneHancer (GH) Regulatory Elements for CCDC151 Gene

Promoters and enhancers for CCDC151 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19I011434 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 550.8 +0.1 51 2.5 FOXA2 PKNOX1 SMAD1 ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B ZNF766 PRKCSH CCDC151 KRI1 ILF3 ZNF700 ZNF44 ZNF878 SWSAP1 ZNF433-AS1 ZNF20
GH19I011530 Enhancer 1.4 FANTOM5 Ensembl ENCODE 5 -94.7 -94719 0.6 PKNOX1 MLX ARID4B SIN3A ZNF48 ETS1 SLC30A9 FOS RXRA NFYC ECSIT ZNF439 CCDC151 ELAVL3 ZNF491 ZNF653 ZNF441 GC19P011537
GH19I011478 Promoter/Enhancer 2.1 EPDnew FANTOM5 Ensembl ENCODE 3.3 -45.8 -45844 5.4 HDGF PKNOX1 CLOCK SMAD1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 ELAVL3 ILF3 KRI1 ZNF627 ZNF136 TIMM29 ZNF44 ZNF441 ENSG00000242615 ZNF700
GH19I011373 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 2.1 +59.5 59462 6.2 HDGF PKNOX1 SMAD1 ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 PIR61774 SWSAP1 ENSG00000267277 ILF3 KRI1 ZNF627 ZNF136 ZNF442 ZNF844 ZNF44
GH19I011420 Enhancer 1.1 Ensembl ENCODE 0.4 +14.1 14090 2.8 PKNOX1 KLF17 ETS1 ZNF335 GLIS2 E2F8 ZNF366 ZNF143 IKZF2 RUNX3 RGL3 CCDC151 PRKCSH
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CCDC151 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CCDC151 gene promoter:

Genomic Locations for CCDC151 Gene

Genomic Locations for CCDC151 Gene
15,179 bases
Minus strand

Genomic View for CCDC151 Gene

Genes around CCDC151 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CCDC151 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CCDC151 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CCDC151 Gene

Proteins for CCDC151 Gene

  • Protein details for CCDC151 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Coiled-coil domain-containing protein 151
    Protein Accession:
    Secondary Accessions:
    • B4DXT0
    • Q96CG5

    Protein attributes for CCDC151 Gene

    595 amino acids
    Molecular mass:
    69140 Da
    Quaternary structure:
    • Interacts with CCDC114.

    Alternative splice isoforms for CCDC151 Gene


neXtProt entry for CCDC151 Gene

Post-translational modifications for CCDC151 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for CCDC151 Gene

No data available for DME Specific Peptides for CCDC151 Gene

Domains & Families for CCDC151 Gene

Gene Families for CCDC151 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for CCDC151 Gene


Suggested Antigen Peptide Sequences for CCDC151 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with CCDC151: view

No data available for UniProtKB/Swiss-Prot for CCDC151 Gene

Function for CCDC151 Gene

Molecular function for CCDC151 Gene

UniProtKB/Swiss-Prot Function:
Ciliary protein involved in outer dynein arm assembly and required for motile cilia function.

Gene Ontology (GO) - Molecular Function for CCDC151 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 23455924
genes like me logo Genes that share ontologies with CCDC151: view
genes like me logo Genes that share phenotypes with CCDC151: view

Human Phenotype Ontology for CCDC151 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

miRNA for CCDC151 Gene

miRTarBase miRNAs that target CCDC151

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Animal Models , Transcription Factor Targets and HOMER Transcription for CCDC151 Gene

Localization for CCDC151 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CCDC151 Gene

Cell projection, cilium. Cytoplasm, cytoskeleton, cilium basal body. Cytoplasm, cytoskeleton, microtubule organizing center, centrosome, centriole. Cytoplasm, cytoskeleton, cilium axoneme.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CCDC151 gene
Compartment Confidence
cytoskeleton 5
nucleus 4
cytosol 2
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CCDC151 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005814 centriole ISS --
GO:0005856 cytoskeleton IEA --
GO:0005929 cilium IEA,ISS --
GO:0005930 axoneme IDA 25192045
genes like me logo Genes that share ontologies with CCDC151: view

Pathways & Interactions for CCDC151 Gene

SuperPathways for CCDC151 Gene

No Data Available

Gene Ontology (GO) - Biological Process for CCDC151 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003341 cilium movement IMP 25192045
GO:0007368 determination of left/right symmetry IMP 25192045
GO:0030030 cell projection organization IEA --
GO:0036158 outer dynein arm assembly IDA 25192045
GO:0070286 axonemal dynein complex assembly IEA --
genes like me logo Genes that share ontologies with CCDC151: view

No data available for Pathways by source and SIGNOR curated interactions for CCDC151 Gene

Drugs & Compounds for CCDC151 Gene

No Compound Related Data Available

Transcripts for CCDC151 Gene

Unigene Clusters for CCDC151 Gene

Coiled-coil domain containing 151:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CCDC151 Gene

No ASD Table

Relevant External Links for CCDC151 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CCDC151 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CCDC151 Gene

mRNA differential expression in normal tissues according to GTEx for CCDC151 Gene

This gene is overexpressed in Testis (x6.4) and Pituitary (x5.1).

Protein differential expression in normal tissues from HIPED for CCDC151 Gene

This gene is overexpressed in Kidney (34.7), Plasma (17.6), and Liver (11.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for CCDC151 Gene

NURSA nuclear receptor signaling pathways regulating expression of CCDC151 Gene:


SOURCE GeneReport for Unigene cluster for CCDC151 Gene:


Evidence on tissue expression from TISSUES for CCDC151 Gene

  • Eye(4.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CCDC151 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • respiratory
  • skeleton
  • urinary
Head and neck:
  • brain
  • cranial nerve
  • ear
  • epiglottis
  • eye
  • head
  • larynx
  • meninges
  • middle ear
  • mouth
  • neck
  • nose
  • olfactory bulb
  • outer ear
  • pharynx
  • sinus
  • skull
  • bronchus
  • lung
  • trachea
  • spleen
  • ovary
  • testicle
  • blood
  • blood vessel
  • peripheral nervous system
  • white blood cell
genes like me logo Genes that share expression patterns with CCDC151: view

No data available for Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for CCDC151 Gene

Orthologs for CCDC151 Gene

This gene was present in the common ancestor of animals.

Orthologs for CCDC151 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CCDC151 33 34
  • 99.33 (n)
(Bos Taurus)
Mammalia CCDC151 33 34
  • 81.79 (n)
(Canis familiaris)
Mammalia CCDC151 33 34
  • 81.39 (n)
(Rattus norvegicus)
Mammalia Ccdc151 33
  • 76.06 (n)
(Mus musculus)
Mammalia Ccdc151 33 16 34
  • 75.5 (n)
(Monodelphis domestica)
Mammalia CCDC151 34
  • 53 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 39 (a)
-- 34
  • 31 (a)
(Anolis carolinensis)
Reptilia CCDC151 34
  • 40 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ccdc151 33
  • 56.94 (n)
(Danio rerio)
Actinopterygii ccdc151 33 34
  • 52.63 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG14127 34
  • 21 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 41 (a)
Species where no ortholog for CCDC151 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for CCDC151 Gene

Gene Tree for CCDC151 (if available)
Gene Tree for CCDC151 (if available)

Paralogs for CCDC151 Gene

Paralogs for CCDC151 Gene

(2) SIMAP similar genes for CCDC151 Gene using alignment to 6 proteins:

genes like me logo Genes that share paralogs with CCDC151: view

Variants for CCDC151 Gene

Sequence variations from dbSNP and Humsavar for CCDC151 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1053136709 uncertain-significance, Ciliary dyskinesia, primary, 30 11,423,958(-) C/G coding_sequence_variant, missense_variant
rs1060501319 uncertain-significance, Ciliary dyskinesia, primary, 30 11,426,200(-) C/T coding_sequence_variant, intron_variant, missense_variant
rs1060501320 uncertain-significance, Ciliary dyskinesia, primary, 30 11,422,589(-) T/C coding_sequence_variant, downstream_transcript_variant, genic_downstream_transcript_variant, missense_variant
rs1064792932 uncertain-significance, Ciliary dyskinesia, primary, 30 11,426,499(-) CCAGCTCATGTTTGGTCCTCACCA/CCA coding_sequence_variant, inframe_deletion
rs115820640 likely-benign, Polycystic liver disease 11,435,665(-) C/G/T genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for CCDC151 Gene

Variant ID Type Subtype PubMed ID
esv2718178 CNV deletion 23290073
esv2718179 CNV deletion 23290073
nsv519802 CNV loss 19592680
nsv833752 CNV loss 17160897
nsv953975 CNV deletion 24416366

Variation tolerance for CCDC151 Gene

Residual Variation Intolerance Score: 48.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.54; 55.79% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CCDC151 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CCDC151 Gene

Disorders for CCDC151 Gene

MalaCards: The human disease database

(4) MalaCards diseases for CCDC151 Gene - From: HGMD, OMIM, ClinVar, GTR, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
ciliary dyskinesia, primary, 30
  • cild30
kartagener syndrome
  • kartagener's syndrome
ciliary dyskinesia, primary, 1
  • pcd
primary ciliary dyskinesia
  • ciliary motility disorder
- elite association - COSMIC cancer census association via MalaCards


  • Ciliary dyskinesia, primary, 30 (CILD30) [MIM:616037]: A disorder characterized by abnormalities of motile cilia. Respiratory infections leading to chronic inflammation and bronchiectasis are recurrent, due to defects in the respiratory cilia. Patients may exhibit randomization of left-right body asymmetry and situs inversus, due to dysfunction of monocilia at the embryonic node. Primary ciliary dyskinesia associated with situs inversus is referred to as Kartagener syndrome. {ECO:0000269 PubMed:25192045, ECO:0000269 PubMed:25224326}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for CCDC151

genes like me logo Genes that share disorders with CCDC151: view

No data available for Genatlas for CCDC151 Gene

Publications for CCDC151 Gene

  1. The coiled-coil domain containing protein CCDC151 is required for the function of IFT-dependent motile cilia in animals. (PMID: 24067530) Jerber J … Durand B (Human molecular genetics 2014) 2 3 58
  2. CCDC151 mutations cause primary ciliary dyskinesia by disruption of the outer dynein arm docking complex formation. (PMID: 25192045) Hjeij R … Mitchison HM (American journal of human genetics 2014) 3 4 58
  3. Nonsense mutation in coiled-coil domain containing 151 gene (CCDC151) causes primary ciliary dyskinesia. (PMID: 25224326) Alsaadi MM … Day IN (Human mutation 2014) 3 4 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58

Products for CCDC151 Gene

Sources for CCDC151 Gene

Loading form....