Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CBS Gene

Aliases for CBS Gene

  • Cystathionine-Beta-Synthase 2 3 5
  • Cystathionine Beta-Synthase 3 4
  • Serine Sulfhydrase 3 4
  • Beta-Thionase 3 4
  • EC 4 56
  • Cystathionine Beta-Synthase-Like Protein 3
  • Methylcysteine Synthase 3
  • CBSL 3
  • HIP4 3

External Ids for CBS Gene

Previous GeneCards Identifiers for CBS Gene

  • GC21M041021
  • GC21M043367
  • GC21M043346
  • GC21M044473
  • GC21M029891

Summaries for CBS Gene

Entrez Gene Summary for CBS Gene

  • The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. This gene is a major contributor to cellular hydrogen sulfide production. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]

GeneCards Summary for CBS Gene

CBS (Cystathionine-Beta-Synthase) is a Protein Coding gene. Diseases associated with CBS include Homocystinuria Due To Cystathionine Beta-Synthase Deficiency and Homocystinuria Due To Cbs Deficiency. Among its related pathways are One carbon pool by folate and Amino Acid metabolism. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity and enzyme binding. An important paralog of this gene is CBSL.

UniProtKB/Swiss-Prot for CBS Gene

  • Hydro-lyase catalyzing the first step of the transsulfuration pathway, where the hydroxyl group of L-serine is displaced by L-homocysteine in a beta-replacement reaction to form L-cystathionine, the precursor of L-cysteine. This catabolic route allows the elimination of L-methionine and the toxic metabolite L-homocysteine (PubMed:23981774, PubMed:20506325, PubMed:23974653). Also involved in the production of hydrogen sulfide, a gasotransmitter with signaling and cytoprotective effects on neurons (By similarity).

Gene Wiki entry for CBS Gene

Additional gene information for CBS Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CBS Gene

Genomics for CBS Gene

GeneHancer (GH) Regulatory Elements for CBS Gene

Promoters and enhancers for CBS Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH21J043074 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 605.9 +1.4 1442 4.2 ZFX ZNF148 MLLT1 CEBPG ZNF384 ZSCAN21 MYC NCOA6 ZBTB7A SP7 CBS WDR4 RRP1B U2AF1 PKNOX1 ENSG00000233754 ENSG00000235772 PIR40419
GH21J042971 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 12.5 +102.9 102879 5.6 SP1 ZFX ELF3 CC2D1A ZKSCAN8 MNT SIX5 ZNF148 NKRF MLLT1 PKNOX1 WDR4 U2AF1 ENSG00000233754 RRP1B CBS NDUFV3 PIR31692
GH21J043044 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 19.7 +29.3 29322 6.4 CTCF CBFA2T2 ZNF121 CEBPG GTF2F1 CSDE1 MAFK TRIM24 SP1 ZNF384 CBS U2AF1 PKNOX1 RRP1B PIR40419
GH21J043052 Enhancer 1.2 Ensembl ENCODE dbSUPER 24.3 +22.9 22942 3.2 ZNF687 ZNF600 PRDM10 ZNF692 POLR2A PKNOX1 ZNF239 ZBTB20 MGA SNRNP70 CBS PIR40419
GH21J043062 Promoter/Enhancer 1.3 Ensembl ENCODE dbSUPER 19.8 +13.0 13019 2.7 POLR2A HMG20B ZNF600 ZBTB26 FOXP1 GATA3 SUPT5H ZFP3 SMAD5 HNF4A CBS PIR40419
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CBS on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CBS gene promoter:
  • Arnt
  • FOXJ2
  • FOXJ2 (long isoform)
  • GR
  • GR-alpha
  • Ik-3
  • Sp1
  • ZIC2

Genomic Locations for CBS Gene

Genomic Locations for CBS Gene
23,753 bases
Minus strand
23,753 bases
Minus strand

Genomic View for CBS Gene

Genes around CBS on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CBS Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CBS Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CBS Gene

Proteins for CBS Gene

  • Protein details for CBS Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Cystathionine beta-synthase
    Protein Accession:
    Secondary Accessions:
    • B2R993
    • D3DSK4
    • Q99425
    • Q9BWC5

    Protein attributes for CBS Gene

    551 amino acids
    Molecular mass:
    60587 Da
    Name=pyridoxal 5'-phosphate; Xref=ChEBI:CHEBI:597326;
    Quaternary structure:
    • Homotetramer.

    Three dimensional structures from OCA and Proteopedia for CBS Gene

    Alternative splice isoforms for CBS Gene


neXtProt entry for CBS Gene

Selected DME Specific Peptides for CBS Gene


Post-translational modifications for CBS Gene

  • Ubiquitination at isoforms=2394
  • Modification sites at PhosphoSitePlus

Domains & Families for CBS Gene

Gene Families for CBS Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for CBS Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ53863, highly similar to Cystathionine beta-synthase (EC (B7Z2D6_HUMAN)
  • Cysteine synthase (C9JMA6_HUMAN)
  • Serine sulfhydrase (CBS_HUMAN)
  • Cystathionine B synthase (Q5CCK6_HUMAN)
  • Cystathionine B synthase (Q5CCK7_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the cysteine synthase/cystathionine beta-synthase family.
  • Belongs to the cysteine synthase/cystathionine beta-synthase family.
genes like me logo Genes that share domains with CBS: view

Function for CBS Gene

Molecular function for CBS Gene

UniProtKB/Swiss-Prot Function:
Hydro-lyase catalyzing the first step of the transsulfuration pathway, where the hydroxyl group of L-serine is displaced by L-homocysteine in a beta-replacement reaction to form L-cystathionine, the precursor of L-cysteine. This catabolic route allows the elimination of L-methionine and the toxic metabolite L-homocysteine (PubMed:23981774, PubMed:20506325, PubMed:23974653). Also involved in the production of hydrogen sulfide, a gasotransmitter with signaling and cytoprotective effects on neurons (By similarity).
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=L-homocysteine + L-serine = H2O + L,L-cystathionine; Xref=Rhea:RHEA:10112, ChEBI:CHEBI:15377, ChEBI:CHEBI:33384, ChEBI:CHEBI:58161, ChEBI:CHEBI:58199; EC=; Evidence={ECO:0000269 PubMed:20506325, ECO:0000269 PubMed:23974653, ECO:0000269 PubMed:23981774, ECO:0000269 PubMed:25044645};.
UniProtKB/Swiss-Prot EnzymeRegulation:
Allosterically activated by S-adenosyl-methionine/AdoMet. Activated by S-adenosylhomocysteine/AdoHcy (PubMed:20506325). Binds non-covalently to a heme group that may control the redox sensitivity of the enzyme (PubMed:11483494, PubMed:12173932, PubMed:22738154).
GENATLAS Biochemistry:
cystathionine beta synthase gene with several transcripts,alternatively spliced in 5',sulfur aminoacid metabolism,susceptibility gene to neural tube defect in association with MTHFR,no evidence of association with NTD in Netherlands and U.K.,interacting with huntingtin

Enzyme Numbers (IUBMB) for CBS Gene

Phenotypes From GWAS Catalog for CBS Gene

Gene Ontology (GO) - Molecular Function for CBS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004122 cystathionine beta-synthase activity IDA 7929220
GO:0004124 cysteine synthase activity IBA 21873635
GO:0005515 protein binding IPI 17087506
GO:0016829 lyase activity IEA --
GO:0019825 oxygen binding IDA 24515102
genes like me logo Genes that share ontologies with CBS: view
genes like me logo Genes that share phenotypes with CBS: view

Human Phenotype Ontology for CBS Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for CBS Gene

miRTarBase miRNAs that target CBS

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CBS

Clone Products

  • Applied Biological Materials (abm): Clones for CBS - Now 50% OFF >
  • * CBS as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * CBS tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
  • Addgene plasmids for CBS

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for CBS Gene

Localization for CBS Gene

Subcellular locations from UniProtKB/Swiss-Prot for CBS Gene

Cytoplasm. Nucleus.

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for CBS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 17087506
GO:0005737 cytoplasm IDA,IBA 23981774
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with CBS: view

No data available for Subcellular locations from COMPARTMENTS for CBS Gene

Pathways & Interactions for CBS Gene

genes like me logo Genes that share pathways with CBS: view

UniProtKB/Swiss-Prot P35520-CBS_HUMAN

  • Pathway: Amino-acid biosynthesis; L-cysteine biosynthesis; L-cysteine from L-homocysteine and L-serine: step 1/2.

SIGNOR curated interactions for CBS Gene

Is activated by:

Gene Ontology (GO) - Biological Process for CBS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006535 cysteine biosynthetic process from serine IEA,IBA 21873635
GO:0006563 L-serine metabolic process IDA 19010420
GO:0006565 L-serine catabolic process IDA 18776696
GO:0008152 metabolic process IEA --
GO:0008652 cellular amino acid biosynthetic process IEA --
genes like me logo Genes that share ontologies with CBS: view

Drugs & Compounds for CBS Gene

(40) Drugs for CBS Gene - From: DrugBank, DGIdb, IUPHAR, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Serine Approved Nutra Full agonist, Agonist, Target Weak endogenous glycine receptor agonist 1256
L-Cysteine Approved Nutra Target 0
Pyridoxal Phosphate Approved, Investigational Nutra Target, cofactor 22
Pyridoxine Approved, Investigational, Vet_approved Nutra 226,226
Ademetionine Approved, Investigational Nutra Target, activator 0

(32) Additional Compounds for CBS Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • 2-amino-4-Mercaptobutyric acid
  • Hcy
  • 2-amino-4-Mercaptobutyrate
  • (+-)-Homocysteine
  • (S)-2-amino-4-mercapto-Butanoate
  • (3S)-5'-[(3-amino-3-Carboxypropyl)methylsulfonio]-5'-deoxyadenosine, inner salt
  • [1-(Adenin-9-yl)-1,5-dideoxy-beta-D-ribofuranos-5-yl][(3S)-3-amino-3-carboxypropyl](methyl)sulfonium
  • Acylcarnitine
  • AdoMet
  • S-(5'-Deoxyadenosin-5'-yl)-L-methionine
  • a-amino-g-(2-amino-2-carboxyethylmercapto)-Butyric acid
  • alpha-amino-gamma-(2-amino-2-carboxyethylmercapto)-Butyric acid
  • DL-Allocystathionine
  • DL-S-(2-amino-2-Carboxyethyl)-homocysteine
  • (R)-S-(2-amino-2-Carboxyethyl)-L-homocysteine
  • L-(+)-Cystathionine
  • S-(beta-amino-beta-Carboxyethyl)homocysteine
  • S-(b-amino-b-Carboxyethyl)homocysteine
  • S-(β-amino-β-carboxyethyl)homocysteine
  • 2-amino-4-[(2-amino-2-Carboxyethyl)selanyl]butyric acid
  • Selenocystathionines
  • 2-amino-4-[(2-amino-2-Carboxyethyl)selanyl]butyrate
  • 2-amino-4-((2-amino-2-Carboxyethyl)seleno)-butanoate
  • 2-amino-4-((2-amino-2-Carboxyethyl)seleno)-butanoic acid
genes like me logo Genes that share compounds with CBS: view

Transcripts for CBS Gene

Unigene Clusters for CBS Gene

Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CBS

Clone Products

  • Applied Biological Materials (abm): Clones for CBS - Now 50% OFF >
  • * CBS as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * CBS tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
  • Addgene plasmids for CBS

Alternative Splicing Database (ASD) splice patterns (SP) for CBS Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b · 3c · 3d · 3e ^ 4a · 4b · 4c · 4d ^ 5 ^ 6a · 6b · 6c ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12a · 12b ^
SP1: - - - - - - - - - -
SP2: - - - - - - - - - -
SP3: - - - - - -
SP4: - - - - - - - -
SP5: -
SP6: -
SP8: - - - -
SP11: - - - - - - - - - - - -
SP12: - - - -
SP15: - -
SP18: - - - -

ExUns: 13a · 13b ^ 14a · 14b ^ 15a · 15b · 15c · 15d ^ 16a · 16b · 16c ^ 17 ^ 18 ^ 19 ^ 20 ^ 21a · 21b · 21c ^ 22a · 22b · 22c
SP1: - - - - -
SP2: - - - - -
SP3: - - - - -
SP4: - - - - -
SP5: - - - - -
SP6: - -
SP7: - -
SP9: -
SP10: - -
SP13: - -
SP14: - -

Relevant External Links for CBS Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CBS Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CBS Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CBS Gene

This gene is overexpressed in Liver (x10.4) and Pancreas (x5.1).

Protein differential expression in normal tissues from HIPED for CBS Gene

This gene is overexpressed in Gallbladder (31.6), Liver, secretome (16.5), and Liver (15.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CBS Gene

Protein tissue co-expression partners for CBS Gene

NURSA nuclear receptor signaling pathways regulating expression of CBS Gene:


SOURCE GeneReport for Unigene cluster for CBS Gene:


mRNA Expression by UniProt/SwissProt for CBS Gene:

Tissue specificity: In the adult strongly expressed in liver and pancreas, some expression in heart and brain, weak expression in lung and kidney. In the fetus, expressed in brain, liver and kidney.

Evidence on tissue expression from TISSUES for CBS Gene

  • Nervous system(4.9)
  • Liver(4.7)
  • Eye(4.6)
  • Lung(4.5)
  • Muscle(4.5)
  • Heart(2.4)
  • Blood(2.3)
  • Pancreas(2.2)
  • Stomach(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CBS Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cranial nerve
  • ear
  • eye
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
  • tooth
  • chest wall
  • clavicle
  • diaphragm
  • esophagus
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • abdominal wall
  • intestine
  • liver
  • pancreas
  • stomach
  • pelvis
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • coagulation system
  • hair
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with CBS: view

Orthologs for CBS Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for CBS Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CBS 35 34
  • 99.33 (n)
(Bos Taurus)
Mammalia CBS 35 34
  • 87.78 (n)
(Canis familiaris)
Mammalia CBS 35 34
  • 86.87 (n)
(Rattus norvegicus)
Mammalia Cbs 34
  • 82.75 (n)
(Mus musculus)
Mammalia Cbs 35 34
  • 82.66 (n)
(Monodelphis domestica)
Mammalia CBS 35
  • 82 (a)
(Ornithorhynchus anatinus)
Mammalia CBS 35
  • 72 (a)
(Gallus gallus)
Aves CBS 35 34
  • 74.18 (n)
(Anolis carolinensis)
Reptilia CBS 35
  • 74 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia cbs 34
  • 72.62 (n)
Str.1560 34
African clawed frog
(Xenopus laevis)
Amphibia cbs-prov 34
(Danio rerio)
Actinopterygii cbsa 35 34
  • 69.21 (n)
cbsb 35
  • 69 (a)
wufq06c06 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.14041 34
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000162 34
  • 60.28 (n)
fruit fly
(Drosophila melanogaster)
Insecta Cbs 35 34
  • 59.65 (n)
CG1753 36
  • 51 (a)
(Caenorhabditis elegans)
Secernentea F54A3.4 36
  • 55 (a)
C17G1.7 36
  • 44 (a)
K10H10.2 36
  • 38 (a)
F59A7.9 36
  • 36 (a)
cbs-2 35
  • 29 (a)
cbs-1 35
  • 27 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AGR012C 34
  • 55.53 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CYS4 37 35 34
  • 51.01 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0F09317g 34
  • 50.6 (n)
(Oryza sativa)
Liliopsida Os06g0564500 34
  • 47.4 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU08216 34
  • 56.24 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.4303 35
  • 56 (a)
Cin.2405 34
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.2405 34
Species where no ortholog for CBS was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CBS Gene

Gene Tree for CBS (if available)
Gene Tree for CBS (if available)
Evolutionary constrained regions (ECRs) for CBS: view image

Paralogs for CBS Gene

Paralogs for CBS Gene

(1) SIMAP similar genes for CBS Gene using alignment to 8 proteins:

  • F5H2U1_HUMAN
  • H7C1W6_HUMAN
  • H7C2H4_HUMAN
  • H7C2W0_HUMAN
genes like me logo Genes that share paralogs with CBS: view

Variants for CBS Gene

Sequence variations from dbSNP and Humsavar for CBS Gene

SNP ID Clin Chr 21 pos Variation AA Info Type
rs1051319 benign, Homocystinuria 43,053,757(-) G/C 3_prime_UTR_variant, genic_downstream_transcript_variant, intron_variant, non_coding_transcript_variant
rs1057516256 likely-pathogenic, Homocystinuria due to CBS deficiency 43,068,508(-) C/T 5_prime_UTR_variant, genic_upstream_transcript_variant, splice_donor_variant, upstream_transcript_variant
rs1057516552 likely-pathogenic, Homocystinuria due to CBS deficiency 43,072,158(-) GGGCCCCACTTCTGCCTGGGGG/GGG 5_prime_UTR_variant, coding_sequence_variant, frameshift, genic_upstream_transcript_variant, non_coding_transcript_variant
rs1057516645 likely-pathogenic, Homocystinuria due to CBS deficiency 43,058,871(-) T/A coding_sequence_variant, non_coding_transcript_variant, stop_gained
rs1057516895 likely-pathogenic, Homocystinuria due to CBS deficiency 43,056,888(-) C/T splice_acceptor_variant

Structural Variations from Database of Genomic Variants (DGV) for CBS Gene

Variant ID Type Subtype PubMed ID
esv2666871 CNV deletion 23128226
esv3647098 CNV loss 21293372
nsv1072185 CNV deletion 25765185
nsv459278 CNV gain 19166990
nsv510800 CNV deletion 20534489
nsv521438 CNV loss 19592680
nsv526609 CNV loss 19592680
nsv587657 CNV gain 21841781
nsv587662 CNV gain 21841781
nsv953637 CNV deletion 24416366

Variation tolerance for CBS Gene

Residual Variation Intolerance Score: 41.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.94; 49.14% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CBS Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
Human Gene Mutation Database (HGMD)

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CBS Gene

Disorders for CBS Gene

MalaCards: The human disease database

(19) MalaCards diseases for CBS Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
homocystinuria due to cystathionine beta-synthase deficiency
  • homocystinuria with or without response to pyridoxine
homocystinuria due to cbs deficiency
  • homocystinuria due to cystathionine beta-synthase deficiency
  • cbs deficiency
homocystinuria caused by cystathionine beta-synthase deficiency
  • classic homocystinuria
pyridoxine deficiency anemia
  • vitamin b6 deficiency syndrome
- elite association - COSMIC cancer census association via MalaCards
Search CBS in MalaCards View complete list of genes associated with diseases


  • Cystathionine beta-synthase deficiency (CBSD) [MIM:236200]: An enzymatic deficiency resulting in altered sulfur metabolism and homocystinuria. The clinical features of untreated homocystinuria due to CBS deficiency include myopia, ectopia lentis, mental retardation, skeletal anomalies resembling Marfan syndrome, and thromboembolic events. Light skin and hair can also be present. Biochemical features include increased urinary homocystine and methionine. {ECO:0000269 PubMed:10215408, ECO:0000269 PubMed:10408774, ECO:0000269 PubMed:10462600, ECO:0000269 PubMed:11013450, ECO:0000269 PubMed:11359213, ECO:0000269 PubMed:11553052, ECO:0000269 PubMed:12007221, ECO:0000269 PubMed:12124992, ECO:0000269 PubMed:12815602, ECO:0000269 PubMed:1301198, ECO:0000269 PubMed:14635102, ECO:0000269 PubMed:15146473, ECO:0000269 PubMed:15365998, ECO:0000269 PubMed:15993874, ECO:0000269 PubMed:16205833, ECO:0000269 PubMed:16429402, ECO:0000269 PubMed:20506325, ECO:0000269 PubMed:21240075, ECO:0000269 PubMed:21520339, ECO:0000269 PubMed:22738154, ECO:0000269 PubMed:23974653, ECO:0000269 PubMed:23981774, ECO:0000269 PubMed:25044645, ECO:0000269 PubMed:7506602, ECO:0000269 PubMed:7564249, ECO:0000269 PubMed:7611293, ECO:0000269 PubMed:7635485, ECO:0000269 PubMed:7762555, ECO:0000269 PubMed:7849717, ECO:0000269 PubMed:7967489, ECO:0000269 PubMed:7981678, ECO:0000269 PubMed:8353501, ECO:0000269 PubMed:8528202, ECO:0000269 PubMed:8755636, ECO:0000269 PubMed:8803779, ECO:0000269 PubMed:8990018, ECO:0000269 PubMed:9156316, ECO:0000269 PubMed:9266356, ECO:0000269 PubMed:9361025, ECO:0000269 PubMed:9889017}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for CBS Gene

homocystinuria,pyridoxine responsive or not responsive forms,neural tube defect,no evidence of association with NTD in Netherlands and U.K.,interacting with huntingtin

Additional Disease Information for CBS

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CBS: view

Publications for CBS Gene

  1. The cystathionine beta-synthase (CBS) mutation c.1224-2A>C in Central Europe: Vitamin B6 nonresponsiveness and a common ancestral haplotype. (PMID: 15365998) Linnebank M … Koch HG (Human mutation 2004) 3 4 23 45 58
  2. The human cystathionine beta-synthase (CBS) gene: complete sequence, alternative splicing, and polymorphisms. (PMID: 9790750) Kraus JP … Kozich V (Genomics 1998) 2 3 4 23 58
  3. Homocysteine level and metabolism in ischemic stroke in the population of Northern Poland. (PMID: 19166826) Sawuła W … Banecki B (Clinical biochemistry 2009) 3 23 45 58
  4. Genetic association study of putative functional single nucleotide polymorphisms of genes in folate metabolism and spina bifida. (PMID: 19683694) Martinez CA … Au KS (American journal of obstetrics and gynecology 2009) 3 23 45 58
  5. Novel associations of CPS1, MUT, NOX4, and DPEP1 with plasma homocysteine in a healthy population: a genome-wide evaluation of 13 974 participants in the Women's Genome Health Study. (PMID: 20031578) Paré G … Ridker PM (Circulation. Cardiovascular genetics 2009) 3 23 45 58

Products for CBS Gene

Sources for CBS Gene