Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CBS Gene

Aliases for CBS Gene

  • Cystathionine-Beta-Synthase 2 3 5
  • Serine Sulfhydrase 3 4
  • Beta-Thionase 3 4
  • EC 4 56
  • Cystathionine Beta-Synthase 3
  • Methylcysteine Synthase 3
  • HIP4 3

External Ids for CBS Gene

Previous GeneCards Identifiers for CBS Gene

  • GC21M041021
  • GC21M043367
  • GC21M043346
  • GC21M044473
  • GC21M029891

Summaries for CBS Gene

Entrez Gene Summary for CBS Gene

  • The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. This gene is a major contributor to cellular hydrogen sulfide production. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]

GeneCards Summary for CBS Gene

CBS (Cystathionine-Beta-Synthase) is a Protein Coding gene. Diseases associated with CBS include Homocystinuria Due To Cystathionine Beta-Synthase Deficiency and Homocystinuria Due To Cbs Deficiency. Among its related pathways are One carbon pool by folate and Viral mRNA Translation. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity and enzyme binding. An important paralog of this gene is CBSL.

UniProtKB/Swiss-Prot for CBS Gene

  • Hydro-lyase catalyzing the first step of the transsulfuration pathway, where the hydroxyl group of L-serine is displaced by L-homocysteine in a beta-replacement reaction to form L-cystathionine, the precursor of L-cysteine. This catabolic route allows the elimination of L-methionine and the toxic metabolite L-homocysteine (PubMed:23981774, PubMed:20506325, PubMed:23974653). Also involved in the production of hydrogen sulfide, a gasotransmitter with signaling and cytoprotective effects on neurons (By similarity).

Gene Wiki entry for CBS Gene

Additional gene information for CBS Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CBS Gene

Genomics for CBS Gene

GeneHancer (GH) Regulatory Elements for CBS Gene

Promoters and enhancers for CBS Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH21I043073 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 556 +1.3 1250 3.4 HDGF ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B ZNF766 ZNF213 CBS WDR4 RRP1B U2AF1 ENSG00000233754 ENSG00000235772 PIR40419
GH21I042971 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 12.5 +102.9 102879 5.6 HDGF HNRNPUL1 PKNOX1 CLOCK FOXA2 ARNT ZFP64 ARID4B SIN3A DMAP1 PKNOX1 WDR4 U2AF1 ENSG00000233754 RRP1B CBS NDUFV3 PIR31692
GH21I043044 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 19.6 +29.3 29329 6.3 FOXA2 PKNOX1 ARNT ARID4B YY1 ZNF766 E2F8 ZNF416 ZNF263 REST CBS U2AF1 PKNOX1 RRP1B PIR40419
GH21I043052 Enhancer 0.9 Ensembl ENCODE 24.3 +23.7 23738 0.6 MEIS2 PKNOX1 TEAD4 POLR2B NCOR1 POLR2A HSF1 TRIM24 KDM4B SNRNP70 CBS PIR40419
GH21I043054 Enhancer 0.8 ENCODE dbSUPER 20.1 +21.9 21937 0.2 SMARCA5 POLR2B E2F8 POLR2A ZNF10 ZNF239 ZNF143 SUPT5H CBS PIR40419
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CBS on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CBS gene promoter:

Genomic Locations for CBS Gene

Genomic Locations for CBS Gene
23,753 bases
Minus strand

Genomic View for CBS Gene

Genes around CBS on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CBS Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CBS Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CBS Gene

Proteins for CBS Gene

  • Protein details for CBS Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Cystathionine beta-synthase
    Protein Accession:
    Secondary Accessions:
    • B2R993
    • D3DSK4
    • Q99425
    • Q9BWC5

    Protein attributes for CBS Gene

    551 amino acids
    Molecular mass:
    60587 Da
    Name=pyridoxal 5-phosphate; Xref=ChEBI:CHEBI:597326;
    Quaternary structure:
    • Homotetramer.

    Three dimensional structures from OCA and Proteopedia for CBS Gene

    Alternative splice isoforms for CBS Gene


neXtProt entry for CBS Gene

Selected DME Specific Peptides for CBS Gene


Post-translational modifications for CBS Gene

Domains & Families for CBS Gene

Gene Families for CBS Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted intracellular proteins

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the cysteine synthase/cystathionine beta-synthase family.
  • Belongs to the cysteine synthase/cystathionine beta-synthase family.
genes like me logo Genes that share domains with CBS: view

Function for CBS Gene

Molecular function for CBS Gene

GENATLAS Biochemistry:
cystathionine beta synthase gene with several transcripts,alternatively spliced in 5,sulfur aminoacid metabolism,susceptibility gene to neural tube defect in association with MTHFR,no evidence of association with NTD in Netherlands and U.K.,interacting with huntingtin
UniProtKB/Swiss-Prot CatalyticActivity:
L-serine + L-homocysteine = L-cystathionine + H(2)O.
UniProtKB/Swiss-Prot EnzymeRegulation:
Allosterically activated by S-adenosyl-methionine/AdoMet. Activated by S-adenosylhomocysteine/AdoHcy (PubMed:20506325). Binds non-covalently to a heme group that may control the redox sensitivity of the enzyme (PubMed:11483494, PubMed:12173932, PubMed:22738154).
UniProtKB/Swiss-Prot Function:
Hydro-lyase catalyzing the first step of the transsulfuration pathway, where the hydroxyl group of L-serine is displaced by L-homocysteine in a beta-replacement reaction to form L-cystathionine, the precursor of L-cysteine. This catabolic route allows the elimination of L-methionine and the toxic metabolite L-homocysteine (PubMed:23981774, PubMed:20506325, PubMed:23974653). Also involved in the production of hydrogen sulfide, a gasotransmitter with signaling and cytoprotective effects on neurons (By similarity).

Enzyme Numbers (IUBMB) for CBS Gene

Phenotypes From GWAS Catalog for CBS Gene

Gene Ontology (GO) - Molecular Function for CBS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004122 cystathionine beta-synthase activity TAS --
GO:0005515 protein binding IPI 17087506
GO:0016829 lyase activity IEA --
GO:0019825 oxygen binding IDA 24515102
GO:0019899 enzyme binding IPI 17087506
genes like me logo Genes that share ontologies with CBS: view
genes like me logo Genes that share phenotypes with CBS: view

Human Phenotype Ontology for CBS Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

miRNA for CBS Gene

miRTarBase miRNAs that target CBS

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for CBS

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for CBS Gene

Localization for CBS Gene

Subcellular locations from UniProtKB/Swiss-Prot for CBS Gene

Cytoplasm. Nucleus.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CBS gene
Compartment Confidence
nucleus 5
cytosol 5
plasma membrane 3
extracellular 2
cytoskeleton 2
mitochondrion 2
endoplasmic reticulum 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for CBS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 17087506
GO:0005737 cytoplasm IDA 23981774
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with CBS: view

Pathways & Interactions for CBS Gene

genes like me logo Genes that share pathways with CBS: view

UniProtKB/Swiss-Prot P35520-CBS_HUMAN

  • Pathway: Amino-acid biosynthesis; L-cysteine biosynthesis; L-cysteine from L-homocysteine and L-serine: step 1/2.

Gene Ontology (GO) - Biological Process for CBS Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006535 cysteine biosynthetic process from serine IEA --
GO:0006563 L-serine metabolic process IDA 19010420
GO:0006565 L-serine catabolic process IDA 18776696
GO:0008152 metabolic process IEA --
GO:0008652 cellular amino acid biosynthetic process IEA --
genes like me logo Genes that share ontologies with CBS: view

No data available for SIGNOR curated interactions for CBS Gene

Drugs & Compounds for CBS Gene

(42) Drugs for CBS Gene - From: DrugBank, DGIdb, IUPHAR, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
L-Cysteine Approved Nutra Target 0
Pyridoxal Phosphate Approved, Investigational Nutra Target, cofactor 17
Pyridoxine Approved, Investigational, Vet_approved Nutra 198,198
Ademetionine Approved, Investigational Nutra Target, activator 0
Water Approved Pharma 0

(32) Additional Compounds for CBS Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • (+-)-homocysteine
  • (S)-2-amino-4-mercapto-Butanoate
  • (S)-2-amino-4-mercapto-Butanoic acid
  • 2-Amino-4-mercapto-Butanoate
  • 2-Amino-4-mercapto-Butanoic acid
  • (3S)-5'-[(3-amino-3-carboxypropyl)methylsulfonio]-5'-deoxyadenosine
  • 2-S-Adenosyl-L-methionine
  • 5'-Deoxyadenosine-5'-L-methionine disulfate ditosylate
  • 5'-Deoxyadenosine-5'-L-methionine disulphate ditosylate
  • Active methionine
  • a-Amino-g-(2-amino-2-carboxyethylmercapto)-Butyric acid
  • alpha-Amino-gamma-(2-amino-2-carboxyethylmercapto)-Butyric acid
  • DL-Allocystathionine
  • DL-S-(2-amino-2-carboxyethyl)-Homocysteine
  • (R)-S-(2-amino-2-carboxyethyl)-L-Homocysteine
  • Cystathionine
  • L-(+)-Cystathionine
  • S-[(2R)-2-Amino-2-carboxyethyl]-L-Homocysteine
  • [R-(R*,S*)]-2-amino-4-[(2-amino-2-carboxyethyl)thio]-Butanoate
  • 2-Amino-4-((2-amino-2-carboxyethyl)seleno)-Butanoate
  • 2-Amino-4-((2-amino-2-carboxyethyl)seleno)-Butanoic acid
  • 2-Amino-4-((2-amino-2-carboxyethyl)seleno)butanoate
  • 2-Amino-4-((2-amino-2-carboxyethyl)seleno)butanoic acid
  • Selenocystathionine
genes like me logo Genes that share compounds with CBS: view

Transcripts for CBS Gene

Unigene Clusters for CBS Gene

Representative Sequences:

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for CBS

Alternative Splicing Database (ASD) splice patterns (SP) for CBS Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b · 3c · 3d · 3e ^ 4a · 4b · 4c · 4d ^ 5 ^ 6a · 6b · 6c ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12a · 12b ^
SP1: - - - - - - - - - -
SP2: - - - - - - - - - -
SP3: - - - - - -
SP4: - - - - - - - -
SP5: -
SP6: -
SP8: - - - -
SP11: - - - - - - - - - - - -
SP12: - - - -
SP15: - -
SP18: - - - -

ExUns: 13a · 13b ^ 14a · 14b ^ 15a · 15b · 15c · 15d ^ 16a · 16b · 16c ^ 17 ^ 18 ^ 19 ^ 20 ^ 21a · 21b · 21c ^ 22a · 22b · 22c
SP1: - - - - -
SP2: - - - - -
SP3: - - - - -
SP4: - - - - -
SP5: - - - - -
SP6: - -
SP7: - -
SP9: -
SP10: - -
SP13: - -
SP14: - -

Relevant External Links for CBS Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CBS Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CBS Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for CBS Gene

This gene is overexpressed in Liver (x10.4) and Pancreas (x5.1).

Protein differential expression in normal tissues from HIPED for CBS Gene

This gene is overexpressed in Gallbladder (31.6), Liver, secretome (16.5), and Liver (15.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for CBS Gene

Protein tissue co-expression partners for CBS Gene

NURSA nuclear receptor signaling pathways regulating expression of CBS Gene:


SOURCE GeneReport for Unigene cluster for CBS Gene:


mRNA Expression by UniProt/SwissProt for CBS Gene:

Tissue specificity: In the adult strongly expressed in liver and pancreas, some expression in heart and brain, weak expression in lung and kidney. In the fetus, expressed in brain, liver and kidney.

Evidence on tissue expression from TISSUES for CBS Gene

  • Nervous system(4.9)
  • Liver(4.7)
  • Eye(4.6)
  • Lung(4.5)
  • Muscle(4.5)
  • Blood(2.3)
  • Heart(2.3)
  • Pancreas(2.2)
  • Stomach(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CBS Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cranial nerve
  • ear
  • eye
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
  • tooth
  • chest wall
  • clavicle
  • diaphragm
  • esophagus
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • abdominal wall
  • intestine
  • liver
  • pancreas
  • stomach
  • pelvis
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • coagulation system
  • hair
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with CBS: view

Primer Products

Orthologs for CBS Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for CBS Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CBS 33 34
  • 99.33 (n)
(Bos Taurus)
Mammalia CBS 33 34
  • 87.78 (n)
(Canis familiaris)
Mammalia CBS 33 34
  • 86.87 (n)
(Rattus norvegicus)
Mammalia Cbs 33
  • 82.75 (n)
(Mus musculus)
Mammalia Cbs 33 34
  • 82.66 (n)
(Monodelphis domestica)
Mammalia CBS 34
  • 82 (a)
(Ornithorhynchus anatinus)
Mammalia CBS 34
  • 72 (a)
(Gallus gallus)
Aves CBS 33 34
  • 74.18 (n)
(Anolis carolinensis)
Reptilia CBS 34
  • 74 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia cbs 33
  • 72.62 (n)
Str.1560 33
African clawed frog
(Xenopus laevis)
Amphibia cbs-prov 33
(Danio rerio)
Actinopterygii cbsa 33 34
  • 69.21 (n)
cbsb 34
  • 69 (a)
wufq06c06 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.14041 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000162 33
  • 60.28 (n)
fruit fly
(Drosophila melanogaster)
Insecta Cbs 33 34
  • 59.65 (n)
CG1753 35
  • 51 (a)
(Caenorhabditis elegans)
Secernentea F54A3.4 35
  • 55 (a)
C17G1.7 35
  • 44 (a)
K10H10.2 35
  • 38 (a)
F59A7.9 35
  • 36 (a)
cbs-2 34
  • 29 (a)
cbs-1 34
  • 27 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AGR012C 33
  • 55.53 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CYS4 33 34 36
  • 51.01 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0F09317g 33
  • 50.6 (n)
(Oryza sativa)
Liliopsida Os06g0564500 33
  • 47.4 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU08216 33
  • 56.24 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.4303 34
  • 56 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.2405 33
Species where no ortholog for CBS was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CBS Gene

Gene Tree for CBS (if available)
Gene Tree for CBS (if available)

Paralogs for CBS Gene

Paralogs for CBS Gene

(1) SIMAP similar genes for CBS Gene using alignment to 8 proteins:

genes like me logo Genes that share paralogs with CBS: view

Variants for CBS Gene

Sequence variations from dbSNP and Humsavar for CBS Gene

SNP ID Clin Chr 21 pos Variation AA Info Type
rs1051319 benign, Homocystinuria 43,053,757(-) G/C 3_prime_UTR_variant, genic_downstream_transcript_variant, intron_variant, non_coding_transcript_variant
rs1057516256 likely-pathogenic, Homocystinuria due to CBS deficiency 43,068,508(-) C/T genic_upstream_transcript_variant, splice_donor_variant, upstream_transcript_variant
rs1057516552 likely-pathogenic, Homocystinuria due to CBS deficiency 43,072,158(-) GGGCCCCACTTCTGCCTGGGGG/GGG coding_sequence_variant, frameshift, genic_upstream_transcript_variant, non_coding_transcript_variant
rs1057516645 likely-pathogenic, Homocystinuria due to CBS deficiency 43,058,871(-) T/A coding_sequence_variant, non_coding_transcript_variant, stop_gained
rs1057516895 likely-pathogenic, Homocystinuria due to CBS deficiency 43,056,888(-) C/T splice_acceptor_variant

Structural Variations from Database of Genomic Variants (DGV) for CBS Gene

Variant ID Type Subtype PubMed ID
nsv953637 CNV deletion 24416366
nsv587662 CNV gain 21841781
nsv587657 CNV gain 21841781
nsv526609 CNV loss 19592680
nsv521438 CNV loss 19592680
nsv510800 CNV deletion 20534489
nsv459278 CNV gain 19166990
nsv1072185 CNV deletion 25765185
esv3647098 CNV loss 21293372
esv2666871 CNV deletion 23128226

Variation tolerance for CBS Gene

Residual Variation Intolerance Score: 41.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.94; 49.14% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CBS Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CBS Gene

Disorders for CBS Gene

MalaCards: The human disease database

(51) MalaCards diseases for CBS Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
homocystinuria due to cystathionine beta-synthase deficiency
  • homocystinuria with or without response to pyridoxine
homocystinuria due to cbs deficiency
  • cbs deficiency
  • cbs deficiency
  • hyperhomocysteinemia
homocystinuria caused by cystathionine beta-synthase deficiency
  • classic homocystinuria
- elite association - COSMIC cancer census association via MalaCards
Search CBS in MalaCards View complete list of genes associated with diseases


  • Cystathionine beta-synthase deficiency (CBSD) [MIM:236200]: An enzymatic deficiency resulting in altered sulfur metabolism and homocystinuria. The clinical features of untreated homocystinuria due to CBS deficiency include myopia, ectopia lentis, mental retardation, skeletal anomalies resembling Marfan syndrome, and thromboembolic events. Light skin and hair can also be present. Biochemical features include increased urinary homocystine and methionine. {ECO:0000269 PubMed:10215408, ECO:0000269 PubMed:10408774, ECO:0000269 PubMed:10462600, ECO:0000269 PubMed:11013450, ECO:0000269 PubMed:11359213, ECO:0000269 PubMed:11553052, ECO:0000269 PubMed:12007221, ECO:0000269 PubMed:12124992, ECO:0000269 PubMed:12815602, ECO:0000269 PubMed:1301198, ECO:0000269 PubMed:14635102, ECO:0000269 PubMed:15146473, ECO:0000269 PubMed:15365998, ECO:0000269 PubMed:15993874, ECO:0000269 PubMed:16205833, ECO:0000269 PubMed:16429402, ECO:0000269 PubMed:20506325, ECO:0000269 PubMed:21240075, ECO:0000269 PubMed:21520339, ECO:0000269 PubMed:22738154, ECO:0000269 PubMed:23974653, ECO:0000269 PubMed:23981774, ECO:0000269 PubMed:25044645, ECO:0000269 PubMed:7506602, ECO:0000269 PubMed:7564249, ECO:0000269 PubMed:7611293, ECO:0000269 PubMed:7635485, ECO:0000269 PubMed:7762555, ECO:0000269 PubMed:7849717, ECO:0000269 PubMed:7967489, ECO:0000269 PubMed:7981678, ECO:0000269 PubMed:8353501, ECO:0000269 PubMed:8528202, ECO:0000269 PubMed:8755636, ECO:0000269 PubMed:8803779, ECO:0000269 PubMed:8990018, ECO:0000269 PubMed:9156316, ECO:0000269 PubMed:9266356, ECO:0000269 PubMed:9361025, ECO:0000269 PubMed:9889017}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for CBS Gene

homocystinuria,pyridoxine responsive or not responsive forms,neural tube defect,no evidence of association with NTD in Netherlands and U.K.,interacting with huntingtin

Additional Disease Information for CBS

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CBS: view

Publications for CBS Gene

  1. The cystathionine beta-synthase (CBS) mutation c.1224-2A>C in Central Europe: Vitamin B6 nonresponsiveness and a common ancestral haplotype. (PMID: 15365998) Linnebank M … Koch HG (Human mutation 2004) 3 4 22 44 58
  2. The human cystathionine beta-synthase (CBS) gene: complete sequence, alternative splicing, and polymorphisms. (PMID: 9790750) Kraus JP … Kozich V (Genomics 1998) 2 3 4 22 58
  3. Homocysteine level and metabolism in ischemic stroke in the population of Northern Poland. (PMID: 19166826) Sawuła W … Banecki B (Clinical biochemistry 2009) 3 22 44 58
  4. Novel associations of CPS1, MUT, NOX4, and DPEP1 with plasma homocysteine in a healthy population: a genome-wide evaluation of 13 974 participants in the Women's Genome Health Study. (PMID: 20031578) Paré G … Ridker PM (Circulation. Cardiovascular genetics 2009) 3 22 44 58
  5. Genetic association study of putative functional single nucleotide polymorphisms of genes in folate metabolism and spina bifida. (PMID: 19683694) Martinez CA … Au KS (American journal of obstetrics and gynecology 2009) 3 22 44 58

Products for CBS Gene

Sources for CBS Gene