Aliases for CAPN10 Gene
Aliases for CAPN10 Gene
External Ids for CAPN10 Gene
- HGNC: 1477
- Entrez Gene: 11132
- Ensembl: ENSG00000142330
- OMIM: 605286
- UniProtKB: Q9HC96
Previous GeneCards Identifiers for CAPN10 Gene
- GC02M239919
- GC02M240764
- GC02P241545
- GC02P241846
- GC02P241246
- GC02P241174
- GC02P233282
- GC02P241526
Summaries for CAPN10 Gene
-
Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
GeneCards Summary for CAPN10 Gene
CAPN10 (Calpain 10) is a Protein Coding gene. Diseases associated with CAPN10 include Diabetes Mellitus, Noninsulin-Dependent, 1 and Polycystic Ovary Syndrome. Among its related pathways are Focal Adhesion and Integrin Pathway. Gene Ontology (GO) annotations related to this gene include cytoskeletal protein binding and calcium-dependent cysteine-type endopeptidase activity. An important paralog of this gene is CAPN15.
UniProtKB/Swiss-Prot for CAPN10 Gene
-
Calcium-regulated non-lysosomal thiol-protease which catalyzes limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. May play a role in insulin-stimulated glucose uptake.
-
Calpains are a group of calcium-sensitive cysteine proteases that are ubiquitously expressed in mammals. Structurally, calpains contain two subunits; an 80 kDa catalytic subunit and a 28 kDa regulatory subunit that functions as a chaperone to stabilize the 80 kDa structure.
Additional gene information for CAPN10 Gene
- Monarch Initiative
- Search for CAPN10 at DataMed
- Search for CAPN10 at HumanCyc
No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CAPN10 Gene
Genomics for CAPN10 Gene
GeneHancer (GH) Regulatory Elements for CAPN10 Gene
Promoters and enhancers for CAPN10 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)
GeneHancers around CAPN10 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the CAPN10 gene promoter:
-
- STAT3
Regulatory Element Products
Genomic Locations for CAPN10 Gene
Genomic Locations for CAPN10 Gene
- chr2:240,586,716-240,617,705
- (GRCh38/hg38)
- Size:
- 30,990 bases
- Orientation:
- Plus strand
- chr2:241,526,133-241,557,122
- (GRCh37/hg19)
- Size:
- 30,990 bases
- Orientation:
- Plus strand
Genomic View for CAPN10 Gene
Genes around CAPN10 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 2q37.3 by Entrez Gene
- 2q37.3 by HGNC
- 2q37.3 by Ensembl
CAPN10 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for CAPN10 Gene
Proteins for CAPN10 Gene
-
Protein details for CAPN10 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9HC96-CAN10_HUMAN
- Recommended name:
- Calpain-10
- Protein Accession:
- Q9HC96
- A8MVS7
- Q4ZFV1
- Q8NCD4
- Q96IG4
- Q96JI2
- Q9HC89
- Q9HC90
- Q9HC91
- Q9HC92
- Q9HC93
- Q9HC94
- Q9HC95
Protein attributes for CAPN10 Gene
- Size:
- 672 amino acids
- Molecular mass:
- 74952 Da
- Quaternary structure:
- No Data Available
- SequenceCaution:
-
- Sequence=BAB47474.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};
Protein Expression for CAPN10 Gene
Post-translational modifications for CAPN10 Gene
Other Protein References for CAPN10 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for CAPN10
- Novus Biologicals Antibodies for CAPN10
-
Abcam antibodies for CAPN10
- Invitrogen Antibodies for CAPN10
- GeneTex CAPN10 Antibody for CAPN10
-
Boster Bio Antibodies for CAPN10
Protein Products
-
OriGene Purified Proteins for CAPN10
- Search Origene for MassSpec and Protein Over-expression Lysates for CAPN10
- Origene Custom Protein Services for CAPN10
- Search GeneTex for Proteins for CAPN10
-
Abcam proteins for CAPN10
Assay Products
No data available for DME Specific Peptides for CAPN10 Gene
Domains & Families for CAPN10 Gene
Gene Families for CAPN10 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Enzymes
- Potential drug targets
- Predicted intracellular proteins
Protein Domains for CAPN10 Gene
Suggested Antigen Peptide Sequences for CAPN10 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q9HC96- Family:
-
- Belongs to the peptidase C2 family.
Function for CAPN10 Gene
Molecular function for CAPN10 Gene
- UniProtKB/Swiss-Prot Function:
- Calcium-regulated non-lysosomal thiol-protease which catalyzes limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. May play a role in insulin-stimulated glucose uptake.
Enzyme Numbers (IUBMB) for CAPN10 Gene
Phenotypes From GWAS Catalog for CAPN10 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000149 | SNARE binding | ISS | -- |
| GO:0004198 | calcium-dependent cysteine-type endopeptidase activity | IEA,IMP | 15044459 |
| GO:0008092 | cytoskeletal protein binding | ISS | -- |
| GO:0008233 | peptidase activity | IEA | -- |
| GO:0008234 | cysteine-type peptidase activity | IEA | -- |
Phenotypes for CAPN10 Gene
- MGI mutant phenotypes for CAPN10:
- inferred from 2 alleles
- GenomeRNAi human phenotypes for CAPN10:
Animal Models for CAPN10 Gene
Animal Model Products
-
Taconic Biosciences Mouse Models for CAPN10
- Cyagen custom Knockout/knockin (KOKI) mouse models for CAPN10
-
CRISPR Products
-
OriGene CRISPR knockouts for CAPN10
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CAPN10
- genomics-online: gRNA clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
- Applied Biological Materials CRISPR for CAPN10
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for CAPN10
- GenScript: Design CRISPR guide RNA sequences for CAPN10
miRNA for CAPN10 Gene
- miRTarBase miRNAs that target CAPN10
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CAPN10
- Browse OriGene Inhibitory RNA Products For CAPN10
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CAPN10
- genomics-online: shRNA clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
Clone Products
- Sino Biological Human cDNA Clone for CAPN10
- VectorBuilder custom plasmid, inducible vectors for CAPN10
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CAPN10
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CAPN10
- Applied Biological Materials Clones for CAPN10
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for CAPN10
No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for CAPN10 Gene
Localization for CAPN10 Gene
| Compartment | Confidence |
|---|---|
| mitochondrion | 5 |
| cytosol | 5 |
| plasma membrane | 4 |
| nucleus | 3 |
| endoplasmic reticulum | 2 |
| extracellular | 1 |
| peroxisome | 1 |
- Cytosol (2)
- Nucleoplasm (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005622 | intracellular | IEA | -- |
| GO:0005737 | cytoplasm | IBA | -- |
| GO:0005739 | mitochondrion | IDA | 16790502 |
| GO:0005829 | cytosol | ISS | -- |
| GO:0005886 | plasma membrane | ISS | -- |
No data available for Subcellular locations from UniProtKB/Swiss-Prot for CAPN10 Gene
Pathways & Interactions for CAPN10 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | BMP Pathway |
.36
|
|
| 2 | Degradation of the extracellular matrix | ||
| 3 | Apoptosis Pathway | ||
| 4 | Arrhythmogenic right ventricular cardiomyopathy (ARVC) | ||
| 5 | ERK Signaling |
.61
|
|
Pathways by source for CAPN10 Gene
1 BioSystems pathway for CAPN10 Gene
2 Reactome pathways for CAPN10 Gene
1 Tocris pathway for CAPN10 Gene
5 Qiagen pathways for CAPN10 Gene
Interacting Proteins for CAPN10 Gene
GPS-Prot Interaction Network for CAPN10
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006508 | proteolysis | IEA,IMP | 15044459 |
| GO:0006921 | cellular component disassembly involved in execution phase of apoptosis | IC | -- |
| GO:0031532 | actin cytoskeleton reorganization | ISS | 12974673 |
| GO:0032024 | positive regulation of insulin secretion | IMP | 15471947 |
| GO:0032388 | positive regulation of intracellular transport | ISS | 12974673 |
No data available for SIGNOR curated interactions for CAPN10 Gene
Drugs & Compounds for CAPN10 Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| calcium | Approved | Nutra | 0 | |||
| Metformin | Approved | Pharma | AMP-activated protein kinase (AMPK) activator | 1891 | ||
| Tacrolimus | Approved, Investigational | Pharma | 1151 | |||
| Calpeptin | Pharma | Ca2+-dependent protease,calpain inhibitor, Calpain and cathepsin L inhibitor | 0 | |||
| MDL 28170 | Pharma | Calpain and cathepsin B inhibitor, selective, Potent, selective calpain and cathepsin B inhibitor | 0 |
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
(2) Tocris Compounds for CAPN10 Gene
Drug Products
Transcripts for CAPN10 Gene
mRNA/cDNA for CAPN10 Gene
- (8) REFSEQ mRNAs :
- (9) Additional mRNA sequences :
- (153) Selected AceView cDNA sequences:
- (16) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000391984 2644 bps (uc002vzk.2)
- ENST00000463653 787 bps (uc061uiq.1)
- ENST00000404753 2570 bps (uc061uir.1)
- ENST00000270364 1267 bps (uc002vzq.3)
- ENST00000352879 862 bps (uc002vzm.3)
CRISPR Products
-
OriGene CRISPR knockouts for CAPN10
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CAPN10
- genomics-online: gRNA clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
- Applied Biological Materials CRISPR for CAPN10
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for CAPN10
- GenScript: Design CRISPR guide RNA sequences for CAPN10
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CAPN10
- Browse OriGene Inhibitory RNA Products For CAPN10
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CAPN10
- genomics-online: shRNA clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
Clone Products
- Sino Biological Human cDNA Clone for CAPN10
- VectorBuilder custom plasmid, inducible vectors for CAPN10
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CAPN10
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CAPN10
- Applied Biological Materials Clones for CAPN10
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
| ExUns: | 1a | · | 1b | ^ | 2a | · | 2b | ^ | 3a | · | 3b | · | 3c | · | 3d | ^ | 4 | ^ | 5 | ^ | 6a | · | 6b | ^ | 7 | ^ | 8 | ^ | 9 | ^ | 10 | ^ | 11a | · | 11b | ^ | 12a | · | 12b | ^ | 13 | ^ | 14 | ^ | 15a | · | 15b | ^ | 16a | · | 16b | · |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||
| SP2: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
| SP3: | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||
| SP4: | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||
| SP5: | - | - | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||
| SP6: | - | - | - | - | - | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||
| SP7: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
| SP8: | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP9: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP10: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP11: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP12: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP13: | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |||||||||||||||||||||||||||||
| SP14: | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | ||||||||||||||||||||||||||||||||||
| SP15: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP16: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
| SP17: |
| ExUns: | 16c | ^ | 17 | ^ | 18 | ^ | 19 | ^ | 20a | · | 20b | ^ | 21a | · | 21b | · | 21c |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | |||||||||||||||||
| SP2: | |||||||||||||||||
| SP3: | |||||||||||||||||
| SP4: | |||||||||||||||||
| SP5: | |||||||||||||||||
| SP6: | |||||||||||||||||
| SP7: | |||||||||||||||||
| SP8: | |||||||||||||||||
| SP9: | - | - | - | ||||||||||||||
| SP10: | |||||||||||||||||
| SP11: | - | - | |||||||||||||||
| SP12: | - | ||||||||||||||||
| SP13: | - | - | - | ||||||||||||||
| SP14: | |||||||||||||||||
| SP15: | |||||||||||||||||
| SP16: | |||||||||||||||||
| SP17: |
Expression for CAPN10 Gene
This gene is overexpressed in Serum (65.1).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CAPN10 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of CAPN10 Gene:
CAPN10SOURCE GeneReport for Unigene cluster for CAPN10 Gene:
Hs.728234mRNA Expression by UniProt/SwissProt for CAPN10 Gene:
Q9HC96-CAN10_HUMAN
Tissue specificity:
Detected in primary skeletal muscle cells (at protein level). Ubiquitous.
Evidence on tissue expression from TISSUES for CAPN10 Gene
- Nervous system(4.8)
- Skin(4.5)
- Lung(4)
- Pancreas(3.4)
- Intestine(2.6)
- Bone(2.5)
- Eye(2.3)
- Blood(2.1)
- Liver(2)
Primer Products
-
OriGene qPCR primer pairs and template standards for CAPN10
-
OriGene qPCR primer pairs for CAPN10
- genomics-online: primer clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for CAPN10 Gene
Orthologs for CAPN10 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | CAPN10 34 33 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | LOC789674 33 |
|
||
| CAPN10 34 |
|
OneToOne | |||
| dog (Canis familiaris) |
Mammalia | CAPN10 34 33 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Capn10 33 |
|
||
| mouse (Mus musculus) |
Mammalia | Capn10 16 34 33 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | CAPN10 34 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | -- 34 |
|
OneToMany | |
| -- 34 |
|
OneToMany | |||
| chicken (Gallus gallus) |
Aves | CAPN10 33 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | CAPN10 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | capn10 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | capn10 34 33 |
|
OneToOne | |
| fruit fly (Drosophila melanogaster) |
Insecta | CalpC 34 |
|
OneToOne |
- Species where no ortholog for CAPN10 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Evolution for CAPN10 Gene
- ENSEMBL:
- Gene Tree for CAPN10 (if available)
- TreeFam:
- Gene Tree for CAPN10 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for CAPN10: view image
Paralogs for CAPN10 Gene
Variants for CAPN10 Gene
| SNP ID | Clin | Chr 02 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs2975760 | risk-factor, Diabetes mellitus type 2, Polycystic ovary syndrome, susceptibility to | 240,591,746(+) | T/C | intron_variant | |
| rs3792267 | risk-factor, Diabetes mellitus type 2 | 240,591,757(+) | G/A | intron_variant | |
| rs3842570 | risk-factor, Diabetes mellitus type 2 | 240,594,825(+) | GATGATTCTGTCCCAGGAGCCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC/GATGATTCTGTCCCAGGAGCCGGGAGGAGGGTGATGATTCTGTCCCAGGAGCCGGGAGGAGGGTGATGATTCTGTCCCAGGAGC | intron_variant | |
| VAR_036049 | A colorectal cancer sample | p.Glu276Gly | |||
| rs774748418 | likely-benign, not specified | 240,597,920(+) | C/T | coding_sequence_variant, synonymous_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| esv2759119 | CNV | gain | 17122850 |
| nsv1001262 | CNV | gain | 25217958 |
| nsv470529 | CNV | loss | 18288195 |
| nsv834586 | CNV | loss | 17160897 |
| nsv955291 | CNV | deletion | 24416366 |
Residual Variation Intolerance Score:
18.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
2.89;
48.62% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for CAPN10 Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CAPN10 Gene
Disorders for CAPN10 Gene
(6) MalaCards diseases for CAPN10 Gene - From: HGMD, OMIM, ClinVar, GTR, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| diabetes mellitus, noninsulin-dependent, 1 |
|
|
| polycystic ovary syndrome |
|
|
| diabetes mellitus |
|
|
| diabetes mellitus, noninsulin-dependent |
|
|
| gestational diabetes |
|
Search CAPN10 in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
CAN10_HUMAN- Diabetes mellitus, non-insulin-dependent, 1 (NIDDM1) [MIM:601283]: A multifactorial disorder of glucose homeostasis caused by a lack of sensitivity to the bodys own insulin. Affected individuals usually have an obese body habitus and manifestations of a metabolic syndrome characterized by diabetes, insulin resistance, hypertension and hypertriglyceridemia. The disease results in long-term complications that affect the eyes, kidneys, nerves, and blood vessels. {ECO:0000269 PubMed:11017071, ECO:0000269 PubMed:16721485}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
Additional Disease Information for CAPN10
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for CAPN10 Gene
Publications for CAPN10 Gene
- Genetic variation in the gene encoding calpain-10 is associated with type 2 diabetes mellitus. (PMID: 11017071) Horikawa Y … Bell GI (Nature genetics 2000) 2 3 4 22 44 58
- A novel 111/121 diplotype in the Calpain-10 gene is associated with type 2 diabetes. (PMID: 16721485) Kang ES … Lee HC (Journal of human genetics 2006) 3 4 22 44 58
- A calpain-10 gene polymorphism is associated with reduced muscle mRNA levels and insulin resistance. (PMID: 11018080) Baier LJ … Bogardus C (The Journal of clinical investigation 2000) 2 3 22 44 58
- Association of calpain-10 gene polymorphism and posttransplant diabetes mellitus in kidney transplant patients medicated with tacrolimus. (PMID: 19752882) Kurzawski M … Drozdzik M (The pharmacogenomics journal 2010) 3 22 44 58
- Co-existence of risk and protective haplotypes of Calpain 10 gene to type 2 diabetes in the eastern Indian population. (PMID: 20368234) Adak S … Bhattacharyya M (Diabetes & vascular disease research 2010) 3 22 44 58
Products for CAPN10 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for CAPN10
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for CAPN10
- Search Origene for MassSpec and Protein Over-expression Lysates for CAPN10
- Origene Custom Protein Services for CAPN10
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CAPN10
- Browse OriGene Inhibitory RNA Products For CAPN10
- OriGene qPCR primer pairs and template standards for CAPN10
- OriGene qPCR primer pairs for CAPN10
- OriGene CRISPR knockouts for CAPN10
- OriGene ORF clones in human for CAPN10
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For CAPN10
- GenScript: Next-day shipping of latest version cDNA ORF clones for CAPN10 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for CAPN10
- GenScript Custom Assay Services for CAPN10
- GenScript Custom overexpressing Cell Line Services for CAPN10
- GenScript: Design CRISPR guide RNA sequences for CAPN10
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for CAPN10
- Sino Biological Human cDNA Clone for CAPN10
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for CAPN10
- Novus Biologicals proteins and lysates for CAPN10
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for CAPN10
- Abcam proteins for CAPN10
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Taconic Biosciences Mouse Models for CAPN10
- Find your next knockout model in the Taconic Knockout Repository
- Genetically Engineered Models Available Immediately
- Humanized Mice
- Invitrogen Antibodies for CAPN10
- Cyagen custom Knockout/knockin (KOKI) mouse models for CAPN10
- VectorBuilder custom plasmid, inducible vectors for CAPN10
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for CAPN10
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 31 available CAPN10 Antibodies ranked by validation data
- Compare Top CAPN10 Antibodies
- antibodies-online: Search results for 5 available CAPN10 Elisa Kits ranked by validation data
- Compare Top CAPN10 Elisa Kits
- Recommended
- antibodies-online: Search results for 5 available CAPN10 Proteins ranked by validation data
- Compare Top CAPN10 Proteins
- GeneTex CAPN10 Antibody for CAPN10
- Search GeneTex for Proteins for CAPN10
- Horizon Cell Lines for CAPN10
- genomics-online: cdna clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
- orf clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
- genomics-online: gRNA clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
- genomics-online: primer clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
- genomics-online: shRNA clones - Search results for 90 available CAPN10 gene related products
- Overview of 90 available CAPN10 gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CAPN10
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CAPN10
- GeneCopoeia miRNA 3'UTR Target clone products for CAPN10
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CAPN10
- Boster Bio Antibodies for CAPN10
- Browse Boster Bio ELISA Kits
Sources for CAPN10 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt