Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CALR Gene

Aliases for CALR Gene

  • Calreticulin 2 3 4 5
  • Sicca Syndrome Antigen A (Autoantigen Ro; Calreticulin) 2 3
  • Endoplasmic Reticulum Resident Protein 60 3 4
  • Calregulin 3 4
  • CRP55 3 4
  • ERp60 3 4
  • HACBP 3 4
  • Grp60 3 4
  • Epididymis Secretory Sperm Binding Protein Li 99n 3
  • Autoantigen Ro 2
  • HEL-S-99n 3
  • CC1qR 3
  • CRTC 4
  • CRT 3
  • SSA 3
  • RO 3

External Ids for CALR Gene

Previous GeneCards Identifiers for CALR Gene

  • GC19P013180
  • GC19P013272
  • GC19P012894
  • GC19P012910
  • GC19P013049
  • GC19P012621

Summaries for CALR Gene

Entrez Gene Summary for CALR Gene

  • Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]

CIViC summary for CALR Gene

GeneCards Summary for CALR Gene

CALR (Calreticulin) is a Protein Coding gene. Diseases associated with CALR include Essential Thrombocythemia and Myelofibrosis. Among its related pathways are Human cytomegalovirus infection and Human T-cell leukemia virus 1 infection. Gene Ontology (GO) annotations related to this gene include ubiquitin protein ligase binding. An important paralog of this gene is CALR3.

UniProtKB/Swiss-Prot for CALR Gene

  • Calcium-binding chaperone that promotes folding, oligomeric assembly and quality control in the endoplasmic reticulum (ER) via the calreticulin/calnexin cycle. This lectin interacts transiently with almost all of the monoglucosylated glycoproteins that are synthesized in the ER. Interacts with the DNA-binding domain of NR3C1 and mediates its nuclear export. Involved in maternal gene expression regulation. May participate in oocyte maturation via the regulation of calcium homeostasis (By similarity).

Gene Wiki entry for CALR Gene

Additional gene information for CALR Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CALR Gene

Genomics for CALR Gene

GeneHancer (GH) Regulatory Elements for CALR Gene

Promoters and enhancers for CALR Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19J012936 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 605.4 +0.6 554 5.8 MTA3 ZNF652 SP1 CC2D1A ZFX MNT CBFA2T2 NKRF POLR2A MLLT1 CALR MIR6515 ZNF625 ZNF136 TRMT1 RPS6P25 ZNF844 ZNF442 ZNF788P CCDC130
GH19J013011 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 5.8 +81.6 81617 17.2 ZNF473 ZNF652 SP1 ZFX CC2D1A ELF3 ZNF148 MLLT1 CEBPG RERE NFIX ZNF709 TRMT1 ZNF136 CCDC130 ZNF44 ZNF564 ZNF625 ZNF791 WDR83OS
GH19J012880 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 5 -54.9 -54853 7.1 SP1 ZFX CC2D1A CBFA2T2 ZNF148 NKRF MLLT1 ZNF121 POLR2A GTF2F1 DNASE2 KLF1 ZNF700 CCDC130 ZNF44 WDR83OS ZNF564 MRI1 ZNF791 ZNF878
GH19J013089 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 4.9 +159.1 159140 17.3 SP1 ZFX CC2D1A ELF3 CTCF ZKSCAN8 CBFA2T2 ZNF148 NKRF MLLT1 LYL1 PIR62376 ZNF136 CCDC130 ZNF442 ZNF564 ZNF791 WDR83OS TRMT1 MRI1
GH19J012943 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 5.2 +8.3 8334 6.8 SP1 ZFX ELF3 MNT CBFA2T2 ZNF148 NKRF POLR2A MLLT1 CEBPG RAD23A ZNF136 CCDC130 TRMT1 ZNF442 ZNF625 DHPS MRI1 ZNF844 RPS6P25
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CALR on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CALR gene promoter:
  • AP-1
  • ATF-2
  • c-Jun
  • CUTL1
  • Nkx2-5
  • p53

Genomic Locations for CALR Gene

Genomic Locations for CALR Gene
chr19:12,938,578-12,944,490
(GRCh38/hg38)
Size:
5,913 bases
Orientation:
Plus strand
chr19:13,049,392-13,055,304
(GRCh37/hg19)
Size:
5,913 bases
Orientation:
Plus strand

Genomic View for CALR Gene

Genes around CALR on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CALR Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CALR Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CALR Gene

Proteins for CALR Gene

  • Protein details for CALR Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P27797-CALR_HUMAN
    Recommended name:
    Calreticulin
    Protein Accession:
    P27797
    Secondary Accessions:
    • Q6IAT4
    • Q9UDG2

    Protein attributes for CALR Gene

    Size:
    417 amino acids
    Molecular mass:
    48142 Da
    Quaternary structure:
    • Monomer. Component of an EIF2 complex at least composed of CELF1/CUGBP1, CALR, CALR3, EIF2S1, EIF2S2, HSP90B1 and HSPA5. Interacts with PDIA3/ERp57 and SPACA9 (By similarity). Interacts with TRIM21 (PubMed:8666824). Interacts with NR3C1 (PubMed:11149926). Interacts with PPIB (PubMed:20801878). Interacts (via P-domain) with PDIA5 (PubMed:23614004). Interacts with GABARAP (PubMed:19154346). Interacts with HLA-E-B2M and HLA-G-B2M complexes (PubMed:9427624, PubMed:9640257). Interacts with HLA-F (PubMed:10605026).

    Three dimensional structures from OCA and Proteopedia for CALR Gene

neXtProt entry for CALR Gene

Post-translational modifications for CALR Gene

  • Ubiquitination at posLast=4848, posLast=2424, posLast=5555, and isoforms=159
  • Glycosylation at posLast=344344
  • Modification sites at PhosphoSitePlus
  • Glycosylation from GlyConnect

Other Protein References for CALR Gene

Antibody Products

No data available for DME Specific Peptides for CALR Gene

Domains & Families for CALR Gene

Gene Families for CALR Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Plasma proteins
  • Predicted intracellular proteins
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for CALR Gene

GenScript: Design optimal peptide antigens:
  • cDNA FLJ58668, highly similar to Calreticulin (B4E2Y9_HUMAN)
  • grp60 (CALR_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P27797

UniProtKB/Swiss-Prot:

CALR_HUMAN :
  • Can be divided into a N-terminal globular domain, a proline-rich P-domain forming an elongated arm-like structure and a C-terminal acidic domain. The P-domain binds one molecule of calcium with high affinity, whereas the acidic C-domain binds multiple calcium ions with low affinity.
  • Belongs to the calreticulin family.
Domain:
  • Can be divided into a N-terminal globular domain, a proline-rich P-domain forming an elongated arm-like structure and a C-terminal acidic domain. The P-domain binds one molecule of calcium with high affinity, whereas the acidic C-domain binds multiple calcium ions with low affinity.
  • The interaction with glycans occurs through a binding site in the globular lectin domain.
  • The zinc binding sites are localized to the N-domain.
  • Associates with PDIA3 through the tip of the extended arm formed by the P-domain.
Family:
  • Belongs to the calreticulin family.
genes like me logo Genes that share domains with CALR: view

Function for CALR Gene

Molecular function for CALR Gene

UniProtKB/Swiss-Prot Function:
Calcium-binding chaperone that promotes folding, oligomeric assembly and quality control in the endoplasmic reticulum (ER) via the calreticulin/calnexin cycle. This lectin interacts transiently with almost all of the monoglucosylated glycoproteins that are synthesized in the ER. Interacts with the DNA-binding domain of NR3C1 and mediates its nuclear export. Involved in maternal gene expression regulation. May participate in oocyte maturation via the regulation of calcium homeostasis (By similarity).
GENATLAS Biochemistry:
calreticulin,calcium binding protein of endoplasmic and sarcoplasmic reticulum,48kDa

Phenotypes From GWAS Catalog for CALR Gene

Gene Ontology (GO) - Molecular Function for CALR Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001849 complement component C1q binding TAS 15474971
GO:0003677 DNA binding NAS 11149926
GO:0003723 RNA binding HDA 22658674
GO:0003729 mRNA binding IDA 14726956
GO:0005178 integrin binding IPI 1911778
genes like me logo Genes that share ontologies with CALR: view
genes like me logo Genes that share phenotypes with CALR: view

Human Phenotype Ontology for CALR Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CALR Gene

MGI Knock Outs for CALR:

Animal Model Products

CRISPR Products

miRNA for CALR Gene

miRTarBase miRNAs that target CALR

Clone Products

  • Addgene plasmids for CALR
  • Applied Biological Materials (abm): Clones for CALR - Now 50% OFF >
  • * CALR as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * CALR tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for CALR Gene

Localization for CALR Gene

Subcellular locations from UniProtKB/Swiss-Prot for CALR Gene

Endoplasmic reticulum lumen. Cytoplasm, cytosol. Secreted, extracellular space, extracellular matrix. Cell surface. Sarcoplasmic reticulum lumen. Note=Also found in cell surface (T cells), cytosol and extracellular matrix (PubMed:10358038). Associated with the lytic granules in the cytolytic T-lymphocytes. {ECO:0000269 PubMed:10358038, ECO:0000269 PubMed:8418194}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CALR gene
Compartment Confidence
nucleus 5
endoplasmic reticulum 5
cytosol 5
extracellular 4
plasma membrane 3
golgi apparatus 3
cytoskeleton 2
mitochondrion 2
endosome 1
lysosome 1

Gene Ontology (GO) - Cellular Components for CALR Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001669 acrosomal vesicle IEA --
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space IMP,IEA 22377355
GO:0005634 nucleus IDA,IEA 8107809
GO:0005635 nuclear envelope IDA 21590275
genes like me logo Genes that share ontologies with CALR: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for CALR Gene

Pathways & Interactions for CALR Gene

genes like me logo Genes that share pathways with CALR: view

Gene Ontology (GO) - Biological Process for CALR Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IDA 8107809
GO:0002474 antigen processing and presentation of peptide antigen via MHC class I TAS --
GO:0002479 antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent TAS --
GO:0002502 peptide antigen assembly with MHC class I protein complex ISS 11825569
GO:0006355 regulation of transcription, DNA-templated TAS 8107808
genes like me logo Genes that share ontologies with CALR: view

No data available for SIGNOR curated interactions for CALR Gene

Drugs & Compounds for CALR Gene

(52) Drugs for CALR Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Melatonin Approved, Vet_approved Nutra Antagonist, Full agonist, Agonist, Target Melatonin receptors MT inhibitor, Endogenous hormone; agonist at MT1 and MT2 355
Calcium Approved Nutra 7611
Antihemophilic factor, human recombinant Approved, Investigational Pharma Target, chaperone 0
Calcium Citrate Approved, Investigational Pharma Target, ligand 0
Calcium Phosphate Approved Pharma Target, ligand 0

(37) Additional Compounds for CALR Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with CALR: view

Transcripts for CALR Gene

mRNA/cDNA for CALR Gene

Unigene Clusters for CALR Gene

Calreticulin:
Representative Sequences:

CRISPR Products

Clone Products

  • Addgene plasmids for CALR
  • Applied Biological Materials (abm): Clones for CALR - Now 50% OFF >
  • * CALR as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * CALR tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for CALR Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10a · 10b
SP1:
SP2: -
SP3:
SP4:

Relevant External Links for CALR Gene

GeneLoc Exon Structure for
CALR
ECgene alternative splicing isoforms for
CALR

Expression for CALR Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CALR Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CALR Gene



Protein tissue co-expression partners for CALR Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of CALR Gene:

CALR

SOURCE GeneReport for Unigene cluster for CALR Gene:

Hs.515162

Evidence on tissue expression from TISSUES for CALR Gene

  • Skin(4.9)
  • Nervous system(4.9)
  • Eye(4.8)
  • Liver(4.8)
  • Pancreas(4.8)
  • Lung(4.7)
  • Intestine(4.4)
  • Kidney(4.1)
  • Spleen(3.7)
  • Blood(3.6)
  • Heart(3.6)
  • Muscle(3.4)
  • Stomach(3.4)
  • Bone marrow(3.3)
  • Lymph node(3.3)
  • Thyroid gland(3.1)
  • Bone(2.8)
  • Adrenal gland(2.5)
  • Gall bladder(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CALR Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • immune
  • integumentary
  • lymphatic
  • nervous
  • respiratory
  • skeleton
Regions:
Head and neck:
  • brain
  • ear
  • eye
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
Thorax:
  • chest wall
  • clavicle
  • heart
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • liver
  • spleen
Pelvis:
  • pelvis
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • bone marrow
  • coagulation system
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with CALR: view

No data available for mRNA differential expression in normal tissues , Protein differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for CALR Gene

Orthologs for CALR Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for CALR Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CALR 35 34
  • 99.9 (n)
OneToOne
dog
(Canis familiaris)
Mammalia CALR 35 34
  • 90.61 (n)
OneToOne
cow
(Bos Taurus)
Mammalia CALR 35 34
  • 89.56 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Calr 17 35 34
  • 88.21 (n)
rat
(Rattus norvegicus)
Mammalia Calr 34
  • 87.73 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia CALR 35
  • 85 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CALR 35
  • 83 (a)
OneToOne
chicken
(Gallus gallus)
Aves CALR 35
  • 88 (a)
OneToOne
CALR3 34
  • 66.38 (n)
lizard
(Anolis carolinensis)
Reptilia CALR 35
  • 80 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia calr 34
  • 76.55 (n)
Str.538 34
African clawed frog
(Xenopus laevis)
Amphibia calr-prov 34
zebrafish
(Danio rerio)
Actinopterygii calrl2 35 34
  • 73.72 (n)
OneToOne
calr 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9141 34
fruit fly
(Drosophila melanogaster)
Insecta Crc 35 36 34
  • 69.9 (n)
OneToMany
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004212 34
  • 69.31 (n)
worm
(Caenorhabditis elegans)
Secernentea crt-1 35 36 34
  • 67.35 (n)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CNE1 35
  • 22 (a)
OneToMany
thale cress
(Arabidopsis thaliana)
eudicotyledons CRT1b 34
  • 59.61 (n)
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.1564 34
rice
(Oryza sativa)
Liliopsida Os07g0246200 34
  • 62.81 (n)
Os.7158 34
barley
(Hordeum vulgare)
Liliopsida Hv.1770 34
corn
(Zea mays)
Liliopsida Zm.1288 34
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10660 35
  • 68 (a)
OneToMany
Cin.3623 34
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.3623 34
Species where no ortholog for CALR was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CALR Gene

ENSEMBL:
Gene Tree for CALR (if available)
TreeFam:
Gene Tree for CALR (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CALR: view image

Paralogs for CALR Gene

Paralogs for CALR Gene

(2) SIMAP similar genes for CALR Gene using alignment to 4 proteins:

  • CALR_HUMAN
  • K7EJB9_HUMAN
  • K7EL50_HUMAN
  • K7ELE2_HUMAN

Pseudogenes.org Pseudogenes for CALR Gene

genes like me logo Genes that share paralogs with CALR: view

Variants for CALR Gene

Sequence variations from dbSNP and Humsavar for CALR Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1555760738 pathogenic, Myelofibrosis, Essential thrombocythemia 12,943,751(+) GCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG/GCAGAGG coding_sequence_variant, frameshift
rs1000233859 -- 12,938,499(+) C/ upstream_transcript_variant
rs1000416138 -- 12,941,902(+) C/T intron_variant
rs1000468582 -- 12,942,199(+) T/C intron_variant
rs1000629156 -- 12,942,229(+) G/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for CALR Gene

Variant ID Type Subtype PubMed ID
nsv1160589 CNV duplication 26073780
nsv833754 CNV loss 17160897
nsv953977 CNV deletion 24416366

Variation tolerance for CALR Gene

Residual Variation Intolerance Score: 43.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.89; 35.24% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CALR Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
CALR
Human Gene Mutation Database (HGMD)
CALR

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CALR Gene

Disorders for CALR Gene

MalaCards: The human disease database

(32) MalaCards diseases for CALR Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
essential thrombocythemia
  • essential thrombocythaemia
myelofibrosis
  • myelofibrosis with myeloid metaplasia, somatic
thrombocythemia 1
  • thcyt1
breast mucinous carcinoma
  • invasive mucinous breast carcinoma
rubella
  • german measles
- elite association - COSMIC cancer census association via MalaCards
Search CALR in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

CALR_HUMAN
  • Note=CARL somatic mutations are frequently found in myeloproliferative neoplasms lacking JAK2 or MPL mutations. Myeloproliferative neoplasms are chronic myeloid cancers characterized by overproduction of mature blood cells, and may evolve into acute myeloid leukemia. In addition to chronic myeloid leukemia with the BCR-ABL fusion gene, the three most common myeloproliferative neoplasms are essential thrombocythemia, polycythemia vera, and myelofibrosis. {ECO:0000269 PubMed:24325356, ECO:0000269 PubMed:24325359}.

Additional Disease Information for CALR

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CALR: view

No data available for Genatlas for CALR Gene

Publications for CALR Gene

  1. Calreticulin is expressed on the cell surface of activated human peripheral blood T lymphocytes in association with major histocompatibility complex class I molecules. (PMID: 10358038) Arosa FA … de Sousa M (The Journal of biological chemistry 1999) 3 4 23 58
  2. Calreticulin associates with non-HLA-A,-B class I proteins in the human choriocarcinoma cell lines JEG-3 and BeWo. (PMID: 9640257) Wainwright SD … Holmes CH (Immunology 1998) 3 4 23 58
  3. Human placental calreticulin: purification, characterization and association with other proteins. (PMID: 7841019) Houen G … Koch C (Acta chemica Scandinavica (Copenhagen, Denmark : 1989) 1994) 3 4 23 58
  4. The calcium-binding protein calreticulin is a major constituent of lytic granules in cytolytic T lymphocytes. (PMID: 8418194) Dupuis M … Tschopp J (The Journal of experimental medicine 1993) 3 4 23 58
  5. The 5'-flanking region of the human calreticulin gene shares homology with the human GRP78, GRP94, and protein disulfide isomerase promoters. (PMID: 1733953) McCauliffe DP … Capra JD (The Journal of biological chemistry 1992) 3 4 23 58

Products for CALR Gene