Aliases for CALR Gene
Aliases for CALR Gene
External Ids for CALR Gene
- HGNC: 1455
- Entrez Gene: 811
- Ensembl: ENSG00000179218
- OMIM: 109091
- UniProtKB: P27797
Previous GeneCards Identifiers for CALR Gene
- GC19P013180
- GC19P013272
- GC19P012894
- GC19P012910
- GC19P013049
- GC19P012621
Summaries for CALR Gene
-
Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
GeneCards Summary for CALR Gene
CALR (Calreticulin) is a Protein Coding gene. Diseases associated with CALR include Essential Thrombocythemia and Myelofibrosis. Among its related pathways are Human cytomegalovirus infection and Human T-cell leukemia virus 1 infection. Gene Ontology (GO) annotations related to this gene include ubiquitin protein ligase binding. An important paralog of this gene is CALR3.
UniProtKB/Swiss-Prot for CALR Gene
-
Calcium-binding chaperone that promotes folding, oligomeric assembly and quality control in the endoplasmic reticulum (ER) via the calreticulin/calnexin cycle. This lectin interacts transiently with almost all of the monoglucosylated glycoproteins that are synthesized in the ER. Interacts with the DNA-binding domain of NR3C1 and mediates its nuclear export. Involved in maternal gene expression regulation. May participate in oocyte maturation via the regulation of calcium homeostasis (By similarity).
Additional gene information for CALR Gene
- Monarch Initiative
- Search for CALR at DataMed
- Search for CALR at HumanCyc
No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CALR Gene
Genomics for CALR Gene
GeneHancer (GH) Regulatory Elements for CALR Gene
Promoters and enhancers for CALR Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around CALR on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the CALR gene promoter:
-
- AP-1
- ATF-2
- c-Jun
- CUTL1
- Nkx2-5
- p53
Genomic Locations for CALR Gene
Genomic Locations for CALR Gene
- chr19:12,938,578-12,944,490
- (GRCh38/hg38)
- Size:
- 5,913 bases
- Orientation:
- Plus strand
- chr19:13,049,392-13,055,304
- (GRCh37/hg19)
- Size:
- 5,913 bases
- Orientation:
- Plus strand
Genomic View for CALR Gene
Genes around CALR on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 19p13.13 by HGNC
- 19p13.13 by Entrez Gene
- 19p13.13 by Ensembl
CALR Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for CALR Gene
Proteins for CALR Gene
-
Protein details for CALR Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P27797-CALR_HUMAN
- Recommended name:
- Calreticulin
- Protein Accession:
- P27797
- Q6IAT4
- Q9UDG2
Protein attributes for CALR Gene
- Size:
- 417 amino acids
- Molecular mass:
- 48142 Da
- Quaternary structure:
-
- Monomer. Component of an EIF2 complex at least composed of CELF1/CUGBP1, CALR, CALR3, EIF2S1, EIF2S2, HSP90B1 and HSPA5. Interacts with PDIA3/ERp57 and SPACA9 (By similarity). Interacts with TRIM21 (PubMed:8666824). Interacts with NR3C1 (PubMed:11149926). Interacts with PPIB (PubMed:20801878). Interacts (via P-domain) with PDIA5 (PubMed:23614004). Interacts with GABARAP (PubMed:19154346). Interacts with HLA-E-B2M and HLA-G-B2M complexes (PubMed:9427624, PubMed:9640257). Interacts with HLA-F (PubMed:10605026).
Protein Expression for CALR Gene
Post-translational modifications for CALR Gene
Other Protein References for CALR Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Atlas Antibodies Anti-CALR Antibody
-
Custom Antibody ServicesOriGene Antibodies for CALR
- Novus Biologicals Antibodies for CALR
-
Abcam antibodies for CALR
- Invitrogen Antibodies for CALR (AFLGC-CALR)
- antibodies-online: Search results for 306 available SLC6A8 Antibodies ranked by validation data
- Compare Top SLC6A8 Antibodies
-
Recommended
- 256 WB Antibodies (anti-human)
- 19 FACS Antibodies (anti-human)
- 12 IF (p) Antibodies (anti-human)
- 1 Ct Antibody (anti-human)
- 1 IF Antibody (anti-human)
- 1 IHC (p) Antibody (anti-human)
- 135 WB Antibodies (anti-mouse)
- 12 IF (p) Antibodies (anti-mouse)
- 3 FACS Antibodies (anti-mouse)
- 1 IHC (p) Antibody (anti-mouse)
- 91 WB Antibodies (anti-rat)
- 12 IF (p) Antibodies (anti-rat)
- 1 FACS Antibody (anti-rat)
-
Santa Cruz Biotechnology (SCBT) Antibodies for CALR
- Sino Biological Antibodies for CALR
Protein Products
- Atlas Antibodies PrEST Antigen CALR
- Search Origene for MassSpec and Protein Over-expression Lysates for CALR
- Origene Custom Protein Services for CALR
- Sino Biological Recombinant Proteins for CALR
- Sino Biological Cell Lysates for CALR
- ProSpec Recombinant Proteins for CALR
-
ProSci Proteins for CALR
-
Abcam proteins for CALR
Assay Products
- G Biosciences Immunotag™ Human CALR (Calreticulin) ELISA and Immunotag™ Calreticulin ELISA Kit
- RayBiotech Human Calreticulin ELISA
-
Boster Bio ELISA Kits for CALR
No data available for DME Specific Peptides for CALR Gene
Domains & Families for CALR Gene
Gene Families for CALR Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Cancer-related genes
- Plasma proteins
- Predicted intracellular proteins
- Predicted secreted proteins
Protein Domains for CALR Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for CALR Gene
- GenScript: Design optimal peptide antigens:
-
- cDNA FLJ58668, highly similar to Calreticulin (B4E2Y9_HUMAN)
- grp60 (CALR_HUMAN)
Graphical View of Domain Structure for InterPro Entry
P27797UniProtKB/Swiss-Prot:
CALR_HUMAN :- Can be divided into a N-terminal globular domain, a proline-rich P-domain forming an elongated arm-like structure and a C-terminal acidic domain. The P-domain binds one molecule of calcium with high affinity, whereas the acidic C-domain binds multiple calcium ions with low affinity.
- Belongs to the calreticulin family.
- Domain:
-
- Can be divided into a N-terminal globular domain, a proline-rich P-domain forming an elongated arm-like structure and a C-terminal acidic domain. The P-domain binds one molecule of calcium with high affinity, whereas the acidic C-domain binds multiple calcium ions with low affinity.
- The interaction with glycans occurs through a binding site in the globular lectin domain.
- The zinc binding sites are localized to the N-domain.
- Associates with PDIA3 through the tip of the extended arm formed by the P-domain.
- Family:
-
- Belongs to the calreticulin family.
Function for CALR Gene
Molecular function for CALR Gene
- UniProtKB/Swiss-Prot Function:
- Calcium-binding chaperone that promotes folding, oligomeric assembly and quality control in the endoplasmic reticulum (ER) via the calreticulin/calnexin cycle. This lectin interacts transiently with almost all of the monoglucosylated glycoproteins that are synthesized in the ER. Interacts with the DNA-binding domain of NR3C1 and mediates its nuclear export. Involved in maternal gene expression regulation. May participate in oocyte maturation via the regulation of calcium homeostasis (By similarity).
- GENATLAS Biochemistry:
- calreticulin,calcium binding protein of endoplasmic and sarcoplasmic reticulum,48kDa
Phenotypes From GWAS Catalog for CALR Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001849 | complement component C1q binding | TAS | 15474971 |
| GO:0003677 | DNA binding | NAS | 11149926 |
| GO:0003723 | RNA binding | HDA | 22658674 |
| GO:0003729 | mRNA binding | IDA | 14726956 |
| GO:0005178 | integrin binding | IPI | 1911778 |
Phenotypes for CALR Gene
- MGI mutant phenotypes for CALR:
- inferred from 2 alleles
- GenomeRNAi human phenotypes for CALR:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for CALR
-
CRISPR Products
- Applied Biological Materials (abm): CRISPR Clones for CALR - Now 50% OFF >
- * CALR CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * CALR CRISPR applications: KO, Activation, Repression, and more - Browse All
-
OriGene CRISPR knockouts for CALR
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CALR
- genomics-online: gRNA clones - Search results for 117 available SLC6A8 gene related products
- Overview of 117 available SLC6A8 gene related products
-
Santa Cruz Biotechnology (SCBT) CRISPR for CALR
miRNA for CALR Gene
- miRTarBase miRNAs that target CALR
-
- hsa-mir-124-3p (MIRT022337)
- hsa-mir-122-5p (MIRT023227)
- hsa-mir-1-3p (MIRT023576)
- hsa-mir-16-5p (MIRT031457)
- hsa-mir-423-3p (MIRT042481)
- hsa-mir-320a (MIRT044537)
- hsa-mir-149-5p (MIRT045548)
- bta-mir-31 (MIRT053894)
- bta-mir-181a (MIRT053976)
- hsa-mir-148a-5p (MIRT081250)
- hsa-mir-516a-5p (MIRT081252)
- hsa-mir-875-3p (MIRT081253)
- hsa-mir-1254 (MIRT081254)
- hsa-mir-3116 (MIRT081255)
- hsa-mir-3148 (MIRT081256)
- hsa-mir-3646 (MIRT081257)
- hsa-mir-3662 (MIRT081258)
- hsa-mir-6849-3p (MIRT081259)
- hsa-mir-6782-5p (MIRT399345)
- hsa-mir-412-3p (MIRT441024)
- hsa-mir-6783-3p (MIRT480077)
- hsa-mir-1343-3p (MIRT480078)
- hsa-mir-6848-5p (MIRT480079)
- hsa-mir-6846-5p (MIRT480080)
- hsa-mir-4697-5p (MIRT480081)
- hsa-mir-4488 (MIRT480082)
- hsa-mir-1237-5p (MIRT480083)
- hsa-mir-486-3p (MIRT480084)
- hsa-mir-6721-5p (MIRT480085)
- hsa-mir-6878-5p (MIRT480086)
- hsa-mir-4763-3p (MIRT480087)
- hsa-mir-1207-5p (MIRT480088)
- hsa-mir-6722-3p (MIRT480089)
- hsa-mir-1909-3p (MIRT480090)
- hsa-mir-6738-5p (MIRT480091)
- hsa-mir-5194 (MIRT480092)
- hsa-mir-1914-3p (MIRT480093)
- hsa-mir-1225-3p (MIRT480094)
- hsa-mir-1253 (MIRT480095)
- hsa-mir-3179 (MIRT480096)
- hsa-mir-203a-3p (MIRT480097)
- hsa-mir-5681a (MIRT480098)
- hsa-mir-6742-3p (MIRT480099)
- hsa-mir-637 (MIRT480100)
- hsa-mir-6852-5p (MIRT480101)
- hsa-mir-939-3p (MIRT480102)
- hsa-mir-1910-5p (MIRT480103)
- hsa-mir-6838-3p (MIRT480104)
- hsa-mir-4756-5p (MIRT480105)
- hsa-mir-4739 (MIRT480106)
- hsa-mir-1321 (MIRT480107)
- hsa-mir-5197-3p (MIRT480108)
- hsa-mir-1252-3p (MIRT480109)
- hsa-mir-4533 (MIRT480110)
- hsa-mir-4518 (MIRT480111)
- hsa-mir-4468 (MIRT480112)
- hsa-mir-1266-5p (MIRT480113)
- hsa-mir-3664-3p (MIRT480114)
- hsa-mir-1245b-3p (MIRT480115)
- hsa-mir-6876-5p (MIRT480116)
- hsa-mir-4476 (MIRT480117)
- hsa-mir-2278 (MIRT480118)
- hsa-mir-4428 (MIRT480119)
- hsa-mir-665 (MIRT480120)
- hsa-mir-216a-5p (MIRT480121)
- hsa-mir-4534 (MIRT480122)
- hsa-mir-4665-5p (MIRT480123)
- hsa-mir-1275 (MIRT480124)
- hsa-mir-4472 (MIRT480125)
- hsa-mir-7847-3p (MIRT480126)
- hsa-mir-4447 (MIRT480127)
- hsa-mir-92a-2-5p (MIRT480128)
- hsa-mir-6766-5p (MIRT480129)
- hsa-mir-6756-5p (MIRT480130)
- hsa-mir-608 (MIRT480131)
- hsa-mir-4651 (MIRT480132)
- hsa-mir-7110-5p (MIRT480133)
- hsa-mir-6842-5p (MIRT480134)
- hsa-mir-6752-5p (MIRT480135)
- hsa-mir-5010-5p (MIRT480136)
- hsa-mir-4525 (MIRT480137)
- hsa-mir-6870-5p (MIRT480138)
- hsa-mir-7111-5p (MIRT480139)
- hsa-mir-5698 (MIRT480140)
- hsa-mir-4723-5p (MIRT480141)
- hsa-mir-625-5p (MIRT480142)
- hsa-mir-6825-5p (MIRT480143)
- hsa-mir-3175 (MIRT480144)
- hsa-mir-6883-5p (MIRT480145)
- hsa-mir-6785-5p (MIRT480146)
- hsa-mir-4728-5p (MIRT480147)
- hsa-mir-149-3p (MIRT480148)
- hsa-mir-8085 (MIRT480149)
- hsa-mir-6787-5p (MIRT480150)
- hsa-mir-6731-5p (MIRT480151)
- hsa-mir-663a (MIRT480152)
- hsa-mir-1908-5p (MIRT480153)
- hsa-mir-6894-5p (MIRT480154)
- hsa-mir-765 (MIRT480155)
- hsa-mir-7154-3p (MIRT480156)
- hsa-mir-766-5p (MIRT480157)
- hsa-mir-5192 (MIRT480158)
- hsa-mir-4749-5p (MIRT480159)
- hsa-mir-4706 (MIRT480160)
- hsa-mir-4693-3p (MIRT480161)
- hsa-mir-6889-5p (MIRT480162)
- hsa-mir-6777-5p (MIRT480163)
- hsa-mir-6732-5p (MIRT480164)
- hsa-mir-6783-5p (MIRT480165)
- hsa-mir-4779 (MIRT480166)
- hsa-mir-3141 (MIRT480167)
- hsa-mir-6124 (MIRT512182)
- hsa-mir-342-3p (MIRT524562)
- hsa-mir-6716-3p (MIRT558968)
- hsa-mir-6771-3p (MIRT723641)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CALR
- Browse OriGene Inhibitory RNA Products For CALR
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CALR
- genomics-online: shRNA clones - Search results for 117 available SLC6A8 gene related products
- Overview of 117 available SLC6A8 gene related products
Clone Products
- Applied Biological Materials (abm): Clones for CALR - Now 50% OFF >
- * CALR as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * CALR tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
-
- MG206584
- MR206584
- MR206584L1
- MR206584L1V
- MR206584L2
- MR206584L2V
- MR206584L3
- MR206584L3V
- MR206584L4
- MR206584L4V
- RC203222
- RC203222L1
- RC203222L1V
- RC203222L2
- RC203222L2V
- RC203222L3
- RC203222L3V
- RC203222L4
- RC203222L4V
- RG203222
- RR209415
- RR209415L1
- RR209415L1V
- RR209415L2
- RR209415L2V
- RR209415L3
- RR209415L3V
- RR209415L4
- RR209415L4V
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for CALR
- Addgene plasmids for CALR
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CALR
Cell Line Products
-
Horizon Cell Lines for CALR
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for CALR Gene
Localization for CALR Gene
Subcellular locations from UniProtKB/Swiss-Prot for CALR Gene
- Endoplasmic reticulum lumen. Cytoplasm, cytosol. Secreted, extracellular space, extracellular matrix. Cell surface. Sarcoplasmic reticulum lumen. Note=Also found in cell surface (T cells), cytosol and extracellular matrix (PubMed:10358038). Associated with the lytic granules in the cytolytic T-lymphocytes. {ECO:0000269 PubMed:10358038, ECO:0000269 PubMed:8418194}.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| endoplasmic reticulum | 5 |
| cytosol | 5 |
| extracellular | 4 |
| plasma membrane | 3 |
| golgi apparatus | 3 |
| cytoskeleton | 2 |
| mitochondrion | 2 |
| endosome | 1 |
| lysosome | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001669 | acrosomal vesicle | IEA | -- |
| GO:0005576 | extracellular region | TAS | -- |
| GO:0005615 | extracellular space | IMP,IEA | 22377355 |
| GO:0005634 | nucleus | IDA,IEA | 8107809 |
| GO:0005635 | nuclear envelope | IDA | 21590275 |
No data available for Subcellular locations from the Human Protein Atlas (HPA) for CALR Gene
Pathways & Interactions for CALR Gene
Pathways by source for CALR Gene
3 BioSystems pathways for CALR Gene
24 Reactome pathways for CALR Gene
2 GeneGo (Thomson Reuters) pathways for CALR Gene
2 Qiagen pathways for CALR Gene
2 Cell Signaling Technology pathways for CALR Gene
Interacting Proteins for CALR Gene
Selected Interacting proteins:
P27797-CALR_HUMAN
ENSP00000320866
for CALR Gene via
UniProtKB
MINT
STRING
IID
GPS-Prot Interaction Network for CALR
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000122 | negative regulation of transcription by RNA polymerase II | IDA | 8107809 |
| GO:0002474 | antigen processing and presentation of peptide antigen via MHC class I | TAS | -- |
| GO:0002479 | antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent | TAS | -- |
| GO:0002502 | peptide antigen assembly with MHC class I protein complex | ISS | 11825569 |
| GO:0006355 | regulation of transcription, DNA-templated | TAS | 8107808 |
No data available for SIGNOR curated interactions for CALR Gene
Drugs & Compounds for CALR Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| Melatonin | Approved, Vet_approved | Nutra | Antagonist, Full agonist, Agonist, Target | Melatonin receptors MT inhibitor, Endogenous hormone; agonist at MT1 and MT2 | 355 | |
| Calcium | Approved | Nutra | 7611 | |||
| Antihemophilic factor, human recombinant | Approved, Investigational | Pharma | Target, chaperone | 0 | ||
| Calcium Citrate | Approved, Investigational | Pharma | Target, ligand | 0 | ||
| Calcium Phosphate | Approved | Pharma | Target, ligand | 0 |
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
Drug Products
- Atlas Antibodies PrEST Antigen CALR
Transcripts for CALR Gene
mRNA/cDNA for CALR Gene
- (1) REFSEQ mRNAs :
- (17) Additional mRNA sequences :
- (1816) Selected AceView cDNA sequences:
- (7) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000316448 1903 bps (ENST00000316448.9)
- ENST00000586760 913 bps (ENST00000586760.1)
- ENST00000586803 667 bps (ENST00000586803.1)
- ENST00000586967 394 bps (ENST00000586967.1)
- ENST00000587486 957 bps (ENST00000587486.6)
CRISPR Products
- Applied Biological Materials (abm): CRISPR Clones for CALR - Now 50% OFF >
- * CALR CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * CALR CRISPR applications: KO, Activation, Repression, and more - Browse All
-
OriGene CRISPR knockouts for CALR
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for CALR
- genomics-online: gRNA clones - Search results for 117 available SLC6A8 gene related products
- Overview of 117 available SLC6A8 gene related products
-
Santa Cruz Biotechnology (SCBT) CRISPR for CALR
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for CALR
- Browse OriGene Inhibitory RNA Products For CALR
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for CALR
- genomics-online: shRNA clones - Search results for 117 available SLC6A8 gene related products
- Overview of 117 available SLC6A8 gene related products
Clone Products
- Applied Biological Materials (abm): Clones for CALR - Now 50% OFF >
- * CALR as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * CALR tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
-
- MG206584
- MR206584
- MR206584L1
- MR206584L1V
- MR206584L2
- MR206584L2V
- MR206584L3
- MR206584L3V
- MR206584L4
- MR206584L4V
- RC203222
- RC203222L1
- RC203222L1V
- RC203222L2
- RC203222L2V
- RC203222L3
- RC203222L3V
- RC203222L4
- RC203222L4V
- RG203222
- RR209415
- RR209415L1
- RR209415L1V
- RR209415L2
- RR209415L2V
- RR209415L3
- RR209415L3V
- RR209415L4
- RR209415L4V
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for CALR
- Addgene plasmids for CALR
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for CALR
| ExUns: | 1a | · | 1b | · | 1c | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6 | ^ | 7 | ^ | 8a | · | 8b | ^ | 9 | ^ | 10a | · | 10b |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | |||||||||||||||||||||||||||
| SP2: | - | ||||||||||||||||||||||||||
| SP3: | |||||||||||||||||||||||||||
| SP4: |
Expression for CALR Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Blood (Cardiovascular System)
-
Heart (Cardiovascular System)
- Atrioventricular Canal Cells Atrioventricular Canal
- Outflow Tract
-
Thymus (Hematopoietic System)
- Double Negative 2 Thymocytes Thymus
- Brain (Nervous System)
- Intestine (Gastrointestinal Tract)
- Bone (Muscoskeletal System)
-
Uterus (Reproductive System)
-
Colon (Gastrointestinal Tract)
-
Prostate (Endocrine System)
-
Placenta (Extraembryonic Tissues)
-
Spleen (Hematopoietic System)
-
Thyroid (Endocrine System)
-
Gall Bladder (Hepatobiliary System)
-
Lung (Respiratory System)
-
Kidney (Urinary System)
-
Testis (Reproductive System)
-
Adrenal Gland (Endocrine System)
-
Esophagus (Gastrointestinal Tract)
-
Stomach (Gastrointestinal Tract)
-
Liver (Hepatobiliary System)
-
Pancreas (Endocrine System)
-
Ovary (Reproductive System)
-
Adipose (Muscoskeletal System)
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CALR Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of CALR Gene:
CALRSOURCE GeneReport for Unigene cluster for CALR Gene:
Hs.515162Evidence on tissue expression from TISSUES for CALR Gene
- Skin(4.9)
- Nervous system(4.9)
- Eye(4.8)
- Liver(4.8)
- Pancreas(4.8)
- Lung(4.7)
- Intestine(4.4)
- Kidney(4.1)
- Spleen(3.7)
- Blood(3.6)
- Heart(3.6)
- Muscle(3.4)
- Stomach(3.4)
- Bone marrow(3.3)
- Lymph node(3.3)
- Thyroid gland(3.1)
- Bone(2.8)
- Adrenal gland(2.5)
- Gall bladder(2.1)
Phenotype-based relationships between genes and organs from Gene ORGANizer for CALR Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- cardiovascular
- immune
- integumentary
- lymphatic
- nervous
- respiratory
- skeleton
Regions:
Head and neck:
- brain
- ear
- eye
- head
- jaw
- mandible
- maxilla
- mouth
- neck
- skull
Thorax:
- chest wall
- clavicle
- heart
- lung
- rib
- rib cage
- scapula
- sternum
Abdomen:
- liver
- spleen
Pelvis:
- pelvis
Limb:
- ankle
- arm
- digit
- elbow
- femur
- fibula
- finger
- foot
- forearm
- hand
- hip
- humerus
- knee
- lower limb
- radius
- shin
- shoulder
- thigh
- tibia
- toe
- ulna
- upper limb
- wrist
General:
- blood
- blood vessel
- bone marrow
- coagulation system
- peripheral nerve
- peripheral nervous system
- red blood cell
- skin
- spinal column
- vertebrae
- white blood cell
Primer Products
-
OriGene qPCR primer pairs for CALR
-
OriGene qPCR primer pairs and template standards for CALR
Gene Expression Assay Products
No data available for mRNA differential expression in normal tissues , Protein differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for CALR Gene
Orthologs for CALR Gene
This gene was present in the common ancestor of eukaryotes.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | CALR 35 34 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | CALR 35 34 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | CALR 35 34 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Calr 17 35 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Calr 34 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | CALR 35 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | CALR 35 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | CALR 35 |
|
OneToOne | |
| CALR3 34 |
|
||||
| lizard (Anolis carolinensis) |
Reptilia | CALR 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | calr 34 |
|
||
| Str.538 34 |
|
||||
| African clawed frog (Xenopus laevis) |
Amphibia | calr-prov 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | calrl2 35 34 |
|
OneToOne | |
| calr 34 |
|
||||
| rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.9141 34 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | Crc 35 36 34 |
|
OneToMany | |
| African malaria mosquito (Anopheles gambiae) |
Insecta | AgaP_AGAP004212 34 |
|
||
| worm (Caenorhabditis elegans) |
Secernentea | crt-1 35 36 34 |
|
OneToMany | |
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | CNE1 35 |
|
OneToMany | |
| thale cress (Arabidopsis thaliana) |
eudicotyledons | CRT1b 34 |
|
||
| Alicante grape (Vitis vinifera) |
eudicotyledons | Vvi.1564 34 |
|
||
| rice (Oryza sativa) |
Liliopsida | Os07g0246200 34 |
|
||
| Os.7158 34 |
|
||||
| barley (Hordeum vulgare) |
Liliopsida | Hv.1770 34 |
|
||
| corn (Zea mays) |
Liliopsida | Zm.1288 34 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | CSA.10660 35 |
|
OneToMany | |
| Cin.3623 34 |
|
||||
| sea squirt (Ciona intestinalis) |
Ascidiacea | Cin.3623 34 |
|
- Species where no ortholog for CALR was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for CALR Gene
- ENSEMBL:
- Gene Tree for CALR (if available)
- TreeFam:
- Gene Tree for CALR (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for CALR: view image
Paralogs for CALR Gene
Variants for CALR Gene
| SNP ID | Clin | Chr 19 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1555760738 | pathogenic, Myelofibrosis, Essential thrombocythemia | 12,943,751(+) | GCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG/GCAGAGG | coding_sequence_variant, frameshift | |
| rs1000233859 | -- | 12,938,499(+) | C/ | upstream_transcript_variant | |
| rs1000416138 | -- | 12,941,902(+) | C/T | intron_variant | |
| rs1000468582 | -- | 12,942,199(+) | T/C | intron_variant | |
| rs1000629156 | -- | 12,942,229(+) | G/C | intron_variant |
Residual Variation Intolerance Score:
43.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
1.89;
35.24% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for CALR Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CALR Gene
Disorders for CALR Gene
(32) MalaCards diseases for CALR Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| essential thrombocythemia |
|
|
| myelofibrosis |
|
|
| thrombocythemia 1 |
|
|
| breast mucinous carcinoma |
|
|
| rubella |
|
Search CALR in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
CALR_HUMAN- Note=CARL somatic mutations are frequently found in myeloproliferative neoplasms lacking JAK2 or MPL mutations. Myeloproliferative neoplasms are chronic myeloid cancers characterized by overproduction of mature blood cells, and may evolve into acute myeloid leukemia. In addition to chronic myeloid leukemia with the BCR-ABL fusion gene, the three most common myeloproliferative neoplasms are essential thrombocythemia, polycythemia vera, and myelofibrosis. {ECO:0000269 PubMed:24325356, ECO:0000269 PubMed:24325359}.
Additional Disease Information for CALR
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for CALR Gene
Publications for CALR Gene
- Calreticulin is expressed on the cell surface of activated human peripheral blood T lymphocytes in association with major histocompatibility complex class I molecules. (PMID: 10358038) Arosa FA … de Sousa M (The Journal of biological chemistry 1999) 3 4 23 58
- Calreticulin associates with non-HLA-A,-B class I proteins in the human choriocarcinoma cell lines JEG-3 and BeWo. (PMID: 9640257) Wainwright SD … Holmes CH (Immunology 1998) 3 4 23 58
- Human placental calreticulin: purification, characterization and association with other proteins. (PMID: 7841019) Houen G … Koch C (Acta chemica Scandinavica (Copenhagen, Denmark : 1989) 1994) 3 4 23 58
- The calcium-binding protein calreticulin is a major constituent of lytic granules in cytolytic T lymphocytes. (PMID: 8418194) Dupuis M … Tschopp J (The Journal of experimental medicine 1993) 3 4 23 58
- The 5'-flanking region of the human calreticulin gene shares homology with the human GRP78, GRP94, and protein disulfide isomerase promoters. (PMID: 1733953) McCauliffe DP … Capra JD (The Journal of biological chemistry 1992) 3 4 23 58
ExternalLinks
Products for CALR Gene
- Custom Antibody ServicesOriGene Antibodies for CALR
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for MassSpec and Protein Over-expression Lysates for CALR
- Origene Custom Protein Services for CALR
- Origene