Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CABP2 Gene

Aliases for CABP2 Gene

  • Calcium Binding Protein 2 2 3 5
  • Deafness, Autosomal Recessive 93 2
  • Calcium-Binding Protein 2 3
  • DFNB93 3
  • CaBP2 4

External Ids for CABP2 Gene

Previous HGNC Symbols for CABP2 Gene

  • DFNB93

Previous GeneCards Identifiers for CABP2 Gene

  • GC11M069809
  • GC11M068982
  • GC11M067061
  • GC11M067043
  • GC11M067286
  • GC11M063615

Summaries for CABP2 Gene

Entrez Gene Summary for CABP2 Gene

  • This gene belongs to a subfamily of calcium binding proteins that share similarity to calmodulin. Like calmodulin, these family members can likely stimulate calmodulin-dependent kinase II and the protein phosphatase calcineurin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]

GeneCards Summary for CABP2 Gene

CABP2 (Calcium Binding Protein 2) is a Protein Coding gene. Diseases associated with CABP2 include Deafness, Autosomal Recessive 93 and Autosomal Recessive Non-Syndromic Sensorineural Deafness Type Dfnb. Among its related pathways are Visual Cycle in Retinal Rods. Gene Ontology (GO) annotations related to this gene include calcium ion binding. An important paralog of this gene is CABP1.

UniProtKB/Swiss-Prot for CABP2 Gene

  • Required for sound encoding at inner hair cells (IHCs) synapses, likely via inhibition of the inactivation of voltage-gated calcium channel of type 1.3 (Cav1.3) in the IHCs (PubMed:28183797). Required for the normal transfer of light signals through the retina (By similarity).

Additional gene information for CABP2 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CABP2 Gene

Genomics for CABP2 Gene

GeneHancer (GH) Regulatory Elements for CABP2 Gene

Promoters and enhancers for CABP2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11J067523 Promoter 0.5 EPDnew 650.7 +1.1 1051 0.1 CABP2 CARNS1 CDK2AP2
GH11J066615 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 14.6 +906.6 906583 4.8 HDGF PKNOX1 CLOCK SMAD1 FOXA2 ARID4B SIN3A DMAP1 ZNF2 ZBTB7B RBM4 RBM14 RBM14-RBM4 GC11M066616 PIR51437 PIR40941 ACTN3 EIF1AD KDM2A RAD9A
GH11J068255 Enhancer 1.2 Ensembl ENCODE 14.6 -732.5 -732499 2.3 HDGF ATF1 ARNT ARID4B SIN3A DMAP1 ZNF48 YY1 ZNF766 ARID2 C11orf24 OR7E145P CABP2 NDUFS8 UNC93B1 PIR35627
GH11J067560 Enhancer 1.3 Ensembl ENCODE dbSUPER 11.8 -38.4 -38367 3.9 PKNOX1 ATF1 IRF4 ZNF766 ZNF207 FOS ATF7 RUNX3 DEK RXRA PTPRCAP AIP KMT5B NDUFV1 ENSG00000258297 PPP6R3 RBM14 CABP2 ENSG00000255119 C11orf72
GH11J067593 Enhancer 0.4 ENCODE dbSUPER 10.8 -69.2 -69188 0.2 NUDT8 CABP2 GC11P067588 ENSG00000255119 GC11M067584
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around CABP2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CABP2 gene promoter:

Genomic Locations for CABP2 Gene

Genomic Locations for CABP2 Gene
5,606 bases
Minus strand

Genomic View for CABP2 Gene

Genes around CABP2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CABP2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CABP2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CABP2 Gene

Proteins for CABP2 Gene

  • Protein details for CABP2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Calcium-binding protein 2
    Protein Accession:

    Protein attributes for CABP2 Gene

    220 amino acids
    Molecular mass:
    24482 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for CABP2 Gene


neXtProt entry for CABP2 Gene

Post-translational modifications for CABP2 Gene

No Post-translational modifications

Other Protein References for CABP2 Gene

No data available for DME Specific Peptides for CABP2 Gene

Domains & Families for CABP2 Gene

Gene Families for CABP2 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for CABP2 Gene

Suggested Antigen Peptide Sequences for CABP2 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with CABP2: view

No data available for UniProtKB/Swiss-Prot for CABP2 Gene

Function for CABP2 Gene

Molecular function for CABP2 Gene

UniProtKB/Swiss-Prot Function:
Required for sound encoding at inner hair cells (IHCs) synapses, likely via inhibition of the inactivation of voltage-gated calcium channel of type 1.3 (Cav1.3) in the IHCs (PubMed:28183797). Required for the normal transfer of light signals through the retina (By similarity).

Gene Ontology (GO) - Molecular Function for CABP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005246 calcium channel regulator activity ISS --
GO:0005509 calcium ion binding IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with CABP2: view
genes like me logo Genes that share phenotypes with CABP2: view

Human Phenotype Ontology for CABP2 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for CABP2 Gene

MGI Knock Outs for CABP2:

Animal Model Products

miRNA for CABP2 Gene

miRTarBase miRNAs that target CABP2

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Transcription Factor Targets and HOMER Transcription for CABP2 Gene

Localization for CABP2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CABP2 Gene

Cytoplasm, perinuclear region. Cell membrane; Lipid-anchor; Cytoplasmic side. Golgi apparatus.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CABP2 gene
Compartment Confidence
plasma membrane 5
golgi apparatus 5
cytosol 3
extracellular 1
mitochondrion 1
peroxisome 1
nucleus 1
endoplasmic reticulum 1

Gene Ontology (GO) - Cellular Components for CABP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005794 Golgi apparatus IDA 19338761
GO:0005886 plasma membrane IDA 19338761
GO:0016020 membrane IEA --
GO:0048471 perinuclear region of cytoplasm IEA --
genes like me logo Genes that share ontologies with CABP2: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for CABP2 Gene

Pathways & Interactions for CABP2 Gene

SuperPathways for CABP2 Gene

SuperPathway Contained pathways
1 Visual Cycle in Retinal Rods
genes like me logo Genes that share pathways with CABP2: view

Pathways by source for CABP2 Gene

1 Qiagen pathway for CABP2 Gene

Gene Ontology (GO) - Biological Process for CABP2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007165 signal transduction TAS 10625670
GO:0007601 visual perception ISS --
GO:0007605 sensory perception of sound ISS --
genes like me logo Genes that share ontologies with CABP2: view

No data available for SIGNOR curated interactions for CABP2 Gene

Drugs & Compounds for CABP2 Gene

No Compound Related Data Available

Transcripts for CABP2 Gene

mRNA/cDNA for CABP2 Gene

(7) Selected AceView cDNA sequences:
(3) Additional mRNA sequences :
(3) REFSEQ mRNAs :
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CABP2 Gene

Calcium binding protein 2:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CABP2 Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7

Relevant External Links for CABP2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CABP2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CABP2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

NURSA nuclear receptor signaling pathways regulating expression of CABP2 Gene:


SOURCE GeneReport for Unigene cluster for CABP2 Gene:


mRNA Expression by UniProt/SwissProt for CABP2 Gene:

Tissue specificity: Retina.

Evidence on tissue expression from TISSUES for CABP2 Gene

  • Eye(4.2)
  • Kidney(3.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CABP2 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • nervous
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • eye
  • head
  • inner ear
  • middle ear
  • outer ear
  • skull
  • peripheral nerve
  • peripheral nervous system
genes like me logo Genes that share expression patterns with CABP2: view

No data available for mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression and Protein tissue co-expression partners for CABP2 Gene

Orthologs for CABP2 Gene

This gene was present in the common ancestor of animals.

Orthologs for CABP2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CABP2 34 33
  • 99.55 (n)
(Bos Taurus)
Mammalia CABP2 34 33
  • 92.39 (n)
(Canis familiaris)
Mammalia CABP2 34 33
  • 89.24 (n)
(Rattus norvegicus)
Mammalia Cabp2 33
  • 85.49 (n)
(Mus musculus)
Mammalia Cabp2 16 34 33
  • 85.34 (n)
(Monodelphis domestica)
Mammalia CABP2 34
  • 74 (a)
(Gallus gallus)
Aves CABP2 34 33
  • 75.66 (n)
(Anolis carolinensis)
Reptilia CABP2 34
  • 64 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100487419 33
  • 68.62 (n)
(Danio rerio)
Actinopterygii cabp2a 34 33
  • 73.3 (n)
cabp2b 34
  • 59 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG11638 34
  • 18 (a)
(Caenorhabditis elegans)
Secernentea cal-8 34
  • 32 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 34 (a)
Species where no ortholog for CABP2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CABP2 Gene

Gene Tree for CABP2 (if available)
Gene Tree for CABP2 (if available)
Evolutionary constrained regions (ECRs) for CABP2: view image

Paralogs for CABP2 Gene

(24) SIMAP similar genes for CABP2 Gene using alignment to 3 proteins:

  • F1T0K2_HUMAN
  • F5H458_HUMAN
genes like me logo Genes that share paralogs with CABP2: view

Variants for CABP2 Gene

Sequence variations from dbSNP and Humsavar for CABP2 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs149431491 uncertain-significance, not specified 67,522,571(-) C/T coding_sequence_variant, missense_variant
rs753267072 uncertain-significance, not specified 67,519,941(-) CTGTGGCGGCGTTGGTTGTGGCGTCTG/CTG intron_variant, splice_acceptor_variant
rs1000010545 -- 67,521,486(-) A/T intron_variant
rs1000600618 -- 67,525,250(-) C/A upstream_transcript_variant
rs1000908049 -- 67,525,411(-) G/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for CABP2 Gene

Variant ID Type Subtype PubMed ID
dgv1977n54 CNV loss 21841781
dgv52n111 CNV deletion 26073780
esv2422195 CNV duplication 17116639
nsv521723 CNV loss 19592680
nsv527056 CNV loss 19592680

Variation tolerance for CABP2 Gene

Residual Variation Intolerance Score: 53.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 12.85; 94.81% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CABP2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CABP2 Gene

Disorders for CABP2 Gene

MalaCards: The human disease database

(4) MalaCards diseases for CABP2 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
deafness, autosomal recessive 93
  • dfnb93
autosomal recessive non-syndromic sensorineural deafness type dfnb
  • autosomal recessive isolated neurosensory deafness type dfnb
deafness, autosomal recessive 67
  • dfnb67
  • amoebiasis
- elite association - COSMIC cancer census association via MalaCards
Search CABP2 in MalaCards View complete list of genes associated with diseases


  • Deafness, autosomal recessive, 93 (DFNB93) [MIM:614899]: A form of non-syndromic deafness characterized by stable, bilateral, symmetric, prelingual moderate to severe deafness. Hearing impairment is slightly more pronounced in the mid-frequencies, resulting in a distinctive shallow U-shaped audiogram. {ECO:0000269 PubMed:22981119, ECO:0000269 PubMed:28183797}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for CABP2

genes like me logo Genes that share disorders with CABP2: view

No data available for Genatlas for CABP2 Gene

Publications for CABP2 Gene

  1. A mutation in CABP2, expressed in cochlear hair cells, causes autosomal-recessive hearing impairment. (PMID: 22981119) Schrauwen I … Van Camp G (American journal of human genetics 2012) 2 3 4 58
  2. Five members of a novel Ca(2+)-binding protein (CABP) subfamily with similarity to calmodulin. (PMID: 10625670) Haeseleer F … Palczewski K (The Journal of biological chemistry 2000) 2 3 4 58
  3. Membrane targeting of the EF-hand containing calcium-sensing proteins CaBP7 and CaBP8. (PMID: 19338761) McCue HV … Haynes LP (Biochemical and biophysical research communications 2009) 3 4 58
  4. Ca(2+)-binding proteins in the retina: from discovery to etiology of human disease(1). (PMID: 11108966) Sokal I … Palczewski K (Biochimica et biophysica acta 2000) 3 4 58
  5. Ca2+-binding protein 2 inhibits Ca2+-channel inactivation in mouse inner hair cells. (PMID: 28183797) Picher MM … Moser T (Proceedings of the National Academy of Sciences of the United States of America 2017) 4 58

Products for CABP2 Gene

Sources for CABP2 Gene

Loading form....