Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C21orf2 Gene

Aliases for C21orf2 Gene

  • Chromosome 21 Open Reading Frame 2 2 3 5
  • Leucine-Rich Repeat-Containing Protein 76 3 4
  • Leucine Rich Repeat Containing 76 2 3
  • C21orf-HUMF09G8.5 3 4
  • LRRC76 3 4
  • YF5/A2 3 4
  • Nuclear Encoded Mitochondrial Protein C21orf2 3
  • Nuclear Encoded Mitochondrial Protein 2
  • Protein C21orf2 3
  • SMDAX 3
  • RDMS 3

External Ids for C21orf2 Gene

Previous GeneCards Identifiers for C21orf2 Gene

  • GC21M042258
  • GC21M042341
  • GC21M044605
  • GC21M044573
  • GC21M045749
  • GC21M031119

Summaries for C21orf2 Gene

Entrez Gene Summary for C21orf2 Gene

  • Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]

GeneCards Summary for C21orf2 Gene

C21orf2 (Chromosome 21 Open Reading Frame 2) is a Protein Coding gene. Diseases associated with C21orf2 include Spondylometaphyseal Dysplasia, Axial and Retinal Dystrophy With Or Without Macular Staphyloma.

UniProtKB/Swiss-Prot for C21orf2 Gene

  • Plays a role in cilia formation and/or maintenance (By similarity). Plays a role in the regulation of cell morphology and cytoskeletal organization (PubMed:21834987). Involved in DNA damage repair (PubMed:26290490).

Additional gene information for C21orf2 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C21orf2 Gene

Genomics for C21orf2 Gene

GeneHancer (GH) Regulatory Elements for C21orf2 Gene

Promoters and enhancers for C21orf2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH21I044337 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 620.8 +0.1 59 3.1 HDGF PKNOX1 CLOCK SMAD1 ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 C21orf2 ENSG00000232969 ENSG00000215447 TRPM2 LINC00205 RRP1B ENSG00000184441
GH21I043658 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 19.8 +679.2 679229 2.8 HDGF SMAD1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 SLC30A9 POLR2B RRP1B HSF2BP WDR4 U2AF1 PWP2 ENSG00000233754 ENSG00000184441 PKNOX1 C21orf2 TRAPPC10
GH21I044297 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 16 +37.9 37917 8.5 HDGF CLOCK FOXA2 SMAD1 MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2 PFKL ENSG00000184441 RRP1B C21orf2 ENSG00000215447 PWP2 POFUT2 UBE2G2 PIR46789 GC21P044301
GH21I044239 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 13.2 +96.1 96104 6.9 HDGF PKNOX1 CLOCK FOXA2 SMAD1 MLX ARID4B NEUROD1 SIN3A DMAP1 ICOSLG ENSG00000278158 ENSG00000275799 ENSG00000184441 C21orf2 SIK1 UBE2G2 HSF2BP PWP2 TRAPPC10
GH21I044865 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.7 -531.2 -531206 11.1 HDGF PKNOX1 FOXA2 ARNT ARID4B SIN3A DMAP1 ZNF2 ZBTB7B YY1 PTTG1IP ENSG00000184441 ITGB2 ENSG00000215447 PWP2 POFUT2 C21orf2 UBE2G2 TRPM2 PIR60294
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around C21orf2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the C21orf2 gene promoter:

Genomic Locations for C21orf2 Gene

Genomic Locations for C21orf2 Gene
10,459 bases
Minus strand

Genomic View for C21orf2 Gene

Genes around C21orf2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C21orf2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C21orf2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C21orf2 Gene

Proteins for C21orf2 Gene

  • Protein details for C21orf2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein C21orf2
    Protein Accession:
    Secondary Accessions:
    • A8MPS9
    • O14993
    • Q8N5X6
    • Q99837
    • Q99838

    Protein attributes for C21orf2 Gene

    256 amino acids
    Molecular mass:
    28340 Da
    Quaternary structure:
    • Found in a complex with C21orf2, NEK1 and SPATA7 (PubMed:26167768). Interacts with NEK1 (PubMed:26290490, PubMed:26167768).

    Alternative splice isoforms for C21orf2 Gene


neXtProt entry for C21orf2 Gene

Post-translational modifications for C21orf2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for C21orf2 Gene

Domains & Families for C21orf2 Gene

Gene Families for C21orf2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for C21orf2 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with C21orf2: view

No data available for UniProtKB/Swiss-Prot for C21orf2 Gene

Function for C21orf2 Gene

Molecular function for C21orf2 Gene

GENATLAS Biochemistry:
chromosome 21 open reading frame 2,mitochondrial protein,25kDa,with two alternatively spliced transcripts,widely expressed,encoded by a nuclear gene in the DFNB8/DFNB10 region
UniProtKB/Swiss-Prot Function:
Plays a role in cilia formation and/or maintenance (By similarity). Plays a role in the regulation of cell morphology and cytoskeletal organization (PubMed:21834987). Involved in DNA damage repair (PubMed:26290490).

Phenotypes From GWAS Catalog for C21orf2 Gene

Gene Ontology (GO) - Molecular Function for C21orf2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0005515 protein binding IPI 25416956
genes like me logo Genes that share ontologies with C21orf2: view
genes like me logo Genes that share phenotypes with C21orf2: view

Human Phenotype Ontology for C21orf2 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for C21orf2 Gene

Localization for C21orf2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for C21orf2 Gene

Mitochondrion. Cytoplasm, cytoskeleton, cilium basal body. Cell projection, cilium, photoreceptor outer segment. Cytoplasm. Note=Colocalizes with NEK1 and SPATA7 at the basal body. {ECO:0000269 PubMed:26167768}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for C21orf2 gene
Compartment Confidence
plasma membrane 5
cytoskeleton 5
mitochondrion 5
nucleus 4
cytosol 3
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for C21orf2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001750 photoreceptor outer segment IDA 27548899
GO:0005737 cytoplasm IDA,IEA 21834987
GO:0005739 mitochondrion IDA,IEA 9325172
GO:0005856 cytoskeleton IEA --
GO:0005886 plasma membrane IDA 21834987
genes like me logo Genes that share ontologies with C21orf2: view

Pathways & Interactions for C21orf2 Gene

SuperPathways for C21orf2 Gene

No Data Available

Gene Ontology (GO) - Biological Process for C21orf2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006974 cellular response to DNA damage stimulus IEA --
GO:0007010 cytoskeleton organization IMP 21834987
GO:0008360 regulation of cell shape IMP 21834987
GO:0030030 cell projection organization IEA --
GO:0042769 DNA damage response, detection of DNA damage IDA 26290490
genes like me logo Genes that share ontologies with C21orf2: view

No data available for Pathways by source and SIGNOR curated interactions for C21orf2 Gene

Drugs & Compounds for C21orf2 Gene

No Compound Related Data Available

Transcripts for C21orf2 Gene

Unigene Clusters for C21orf2 Gene

Chromosome 21 open reading frame 2:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for C21orf2 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7a · 7b · 7c ^ 8a · 8b ^ 9 ^ 10a · 10b · 10c · 10d ^ 11 ^ 12
SP1: - - - -
SP2: - - -
SP3: - - -
SP4: - -
SP5: -
SP6: -
SP7: - -

Relevant External Links for C21orf2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for C21orf2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for C21orf2 Gene

Protein differential expression in normal tissues from HIPED for C21orf2 Gene

This gene is overexpressed in Testis (17.3), Adrenal (17.1), Heart (12.5), and Pancreas (6.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for C21orf2 Gene

Protein tissue co-expression partners for C21orf2 Gene

NURSA nuclear receptor signaling pathways regulating expression of C21orf2 Gene:


SOURCE GeneReport for Unigene cluster for C21orf2 Gene:


mRNA Expression by UniProt/SwissProt for C21orf2 Gene:

Tissue specificity: Widely expressed (PubMed:26974433, PubMed:9325172). Expressed in the retina (PubMed:26294103).

Evidence on tissue expression from TISSUES for C21orf2 Gene

  • Lung(4.2)
  • Intestine(4.1)
  • Pancreas(4.1)
  • Nervous system(2.6)
genes like me logo Genes that share expression patterns with C21orf2: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for C21orf2 Gene

Orthologs for C21orf2 Gene

This gene was present in the common ancestor of animals.

Orthologs for C21orf2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia C21H21orf2 33
  • 99.35 (n)
C21orf2 34
  • 98 (a)
(Canis familiaris)
Mammalia C31H21orf2 33
  • 82.87 (n)
C21orf2 34
  • 55 (a)
(Bos Taurus)
Mammalia C1H21orf2 33
  • 80.39 (n)
C1H21ORF2 34
  • 74 (a)
(Mus musculus)
Mammalia 1810043G02Rik 33 16 34
  • 79.38 (n)
(Rattus norvegicus)
Mammalia RGD1309594 33
  • 78.31 (n)
(Ornithorhynchus anatinus)
Mammalia C21orf2 34
  • 65 (a)
(Gallus gallus)
Aves C9H21ORF2 33 34
  • 68.94 (n)
(Anolis carolinensis)
Reptilia C21orf2 34
  • 50 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia c21orf2 33
  • 54.65 (n)
(Danio rerio)
Actinopterygii LOC100537391 33
  • 62.87 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG14995 34
  • 24 (a)
CG15208 34
  • 23 (a)
(Caenorhabditis elegans)
Secernentea F09G8.5 34
  • 19 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.9543 34
  • 31 (a)
Species where no ortholog for C21orf2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for C21orf2 Gene

Gene Tree for C21orf2 (if available)
Gene Tree for C21orf2 (if available)

Paralogs for C21orf2 Gene

No data available for Paralogs for C21orf2 Gene

Variants for C21orf2 Gene

Sequence variations from dbSNP and Humsavar for C21orf2 Gene

SNP ID Clin Chr 21 pos Variation AA Info Type
rs1057518441 dystrophy with or without macular staphyloma (RDMS) [MIM:617547], uncertain-significance, pathogenic, not specified, RETINAL DYSTROPHY WITH OR WITHOUT MACULAR STAPHYLOMA 44,333,224(-) C/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs140451304 pathogenic, likely-pathogenic, Spondylometaphyseal dysplasia axial, Retinitis pigmentosa, Cone/cone-rod dystrophy, Spondylometaphyseal dysplasia, axial (SMDAX) [MIM:602271] 44,333,188(-) C/G/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs555164150 pathogenic, Spondylometaphyseal dysplasia axial, Spondylometaphyseal dysplasia, axial (SMDAX) [MIM:602271] 44,333,075(-) C/G/T coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs567435284 likely-pathogenic, Retinal dystrophy 44,333,137(-) C/A/G/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs746633371 pathogenic, RETINAL DYSTROPHY WITH OR WITHOUT MACULAR STAPHYLOMA 44,331,922(-) TGGGGCCGCCGTGGCCTGTGCCCTCTCTCTCTGGGGCCGC/TGGGGCCGC coding_sequence_variant, frameshift, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for C21orf2 Gene

Variant ID Type Subtype PubMed ID
esv1005686 CNV deletion 20482838
esv1476049 CNV deletion 17803354
esv2723638 CNV deletion 23290073
esv2723642 CNV deletion 23290073
esv2723643 CNV deletion 23290073
esv33817 CNV loss 17666407
esv3647130 CNV gain 21293372
nsv1058359 CNV gain 25217958
nsv1130786 CNV deletion 24896259
nsv509800 CNV insertion 20534489
nsv587740 CNV loss 21841781
nsv587779 CNV loss 21841781
nsv587780 CNV loss 21841781
nsv828907 CNV gain 20364138
nsv828909 CNV gain 20364138
nsv953646 CNV deletion 24416366

Variation tolerance for C21orf2 Gene

Residual Variation Intolerance Score: 95.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.69; 66.05% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for C21orf2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C21orf2 Gene

Disorders for C21orf2 Gene

MalaCards: The human disease database

(8) MalaCards diseases for C21orf2 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards


  • Retinal dystrophy with or without macular staphyloma (RDMS) [MIM:617547]: An ocular disorder characterized by decreased vision which worsen over time, and dystrophic changes in the retina, such as retinal pigment epithelium mottling and vessel narrowing. Macular staphyloma, without high myopia, is present in some patients. {ECO:0000269 PubMed:26294103, ECO:0000269 PubMed:27548899}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Spondylometaphyseal dysplasia, axial (SMDAX) [MIM:602271]: A form of spondylometaphyseal dysplasia, a group of short stature disorders distinguished by abnormalities in the vertebrae and the metaphyses of the tubular bones. SMDAX is characterized by metaphyseal changes of truncal-juxtatruncal bones, including the proximal femora. Main clinical features are postnatal growth failure, rhizomelic short stature in early childhood evolving into short trunk in late childhood, and thoracic hypoplasia that may cause mild to moderate respiratory problems in the neonatal period and later susceptibility to airway infection. Impaired visual acuity comes to medical attention in early life and function rapidly deteriorates. Retinal changes are diagnosed as retinitis pigmentosa or pigmentary retinal degeneration on fundoscopic examination and cone-rod dystrophy on electroretinogram. The radiological hallmarks include short ribs with flared, cupped anterior ends, mild spondylar dysplasia, lacy iliac crests, and metaphyseal irregularities essentially confined to the proximal femora. {ECO:0000269 PubMed:26167768, ECO:0000269 PubMed:26974433, ECO:0000269 PubMed:27548899, ECO:0000269 PubMed:28422394}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for C21orf2

genes like me logo Genes that share disorders with C21orf2: view

No data available for Genatlas for C21orf2 Gene

Publications for C21orf2 Gene

  1. Axial Spondylometaphyseal Dysplasia Is Caused by C21orf2 Mutations. (PMID: 26974433) Wang Z … Ikegawa S (PloS one 2016) 2 3 4 58
  2. Identification of Novel Mutations in the LRR-Cap Domain of C21orf2 in Japanese Patients With Retinitis Pigmentosa and Cone-Rod Dystrophy. (PMID: 27548899) Suga A … Iwata T (Investigative ophthalmology & visual science 2016) 2 3 4 58
  3. The NEK1 interactor, C21ORF2, is required for efficient DNA damage repair. (PMID: 26290490) Fang X … Zhang P (Acta biochimica et biophysica Sinica 2015) 2 3 4 58
  4. Characterization of a novel gene, C21orf2, on human chromosome 21q22.3 and its exclusion as the APECED gene by mutation analysis. (PMID: 9465297) Scott HS … Antonarakis SE (Genomics 1998) 2 3 4 58
  5. Homozygous variant in C21orf2 in a case of Jeune syndrome with severe thoracic involvement: Extending the phenotypic spectrum. (PMID: 28422394) McInerney-Leo AM … Duncan EL (American journal of medical genetics. Part A 2017) 3 4 58

Products for C21orf2 Gene

Sources for C21orf2 Gene

Loading form....