Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C19orf57 Gene

Aliases for C19orf57 Gene

  • Chromosome 19 Open Reading Frame 57 2 3 5
  • Pre-T/NK Cell Associated Protein (3B3) 3
  • Pre-T/NK Cell-Associated Protein 3B3 4
  • Uncharacterized Protein C19orf57 3

External Ids for C19orf57 Gene

Previous GeneCards Identifiers for C19orf57 Gene

  • GC19M013855
  • GC19M013856
  • GC19M013993
  • GC19M013564
  • GC19M013883
  • GC19M013884
  • GC19M013894
  • GC19M013900
  • GC19M013911
  • GC19M013918

Summaries for C19orf57 Gene

GeneCards Summary for C19orf57 Gene

C19orf57 (Chromosome 19 Open Reading Frame 57) is a Protein Coding gene.

Additional gene information for C19orf57 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C19orf57 Gene

Genomics for C19orf57 Gene

GeneHancer (GH) Regulatory Elements for C19orf57 Gene

Promoters and enhancers for C19orf57 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19J013905 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 650.7 +0.1 51 1.7 HDGF PKNOX1 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 POLR2B ZNF766 CC2D1A C19orf57 CCDC130 TRMT1 ZNF333 DCAF15 DDX39A RFX1 SNRPGP15
GH19J013879 Enhancer 1.3 Ensembl ENCODE 13.1 +25.0 24973 3.5 MLX IRF4 YY1 ZNF213 E2F8 ZNF143 SP3 SSRP1 ZNF610 GLIS1 CC2D1A C19orf57 PALM3 EEF1DP1 MISP3 GC19P013876 NANOS3
GH19J013884 Enhancer 1.2 FANTOM5 Ensembl ENCODE 13.1 +20.1 20143 3.3 NCOA3 PKNOX1 KLF1 CLOCK KLF17 BMI1 ZIC2 ZNF48 ZNF121 ZFHX2 CC2D1A C19orf57 PALM3 EEF1DP1 MISP3 IL27RA CCDC130 DCAF15 GC19P013876
GH19J013883 Enhancer 0.5 ENCODE 13.1 +22.6 22599 0.1 CTCF ZNF687 IKZF1 HSF1 ZNF143 REST CC2D1A C19orf57 PALM3 MISP3 EEF1DP1 GC19P013876
GH19J014078 Enhancer 0.5 FANTOM5 Ensembl 11.6 -172.2 -172249 1 NANOS3 PRKACA MIR181D MIR181C C19orf57 CC2D1A ZSWIM4 CCDC130 ADGRE5 RFX1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around C19orf57 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the C19orf57 gene promoter:

Genomic Locations for C19orf57 Gene

Genomic Locations for C19orf57 Gene
chr19:13,882,348-13,906,452
(GRCh38/hg38)
Size:
24,105 bases
Orientation:
Minus strand
chr19:13,993,161-14,017,265
(GRCh37/hg19)

Genomic View for C19orf57 Gene

Genes around C19orf57 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C19orf57 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C19orf57 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C19orf57 Gene

Proteins for C19orf57 Gene

  • Protein details for C19orf57 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q0VDD7-CS057_HUMAN
    Recommended name:
    Uncharacterized protein C19orf57
    Protein Accession:
    Q0VDD7
    Secondary Accessions:
    • Q13411
    • Q8N825
    • Q96D63
    • Q9BU49

    Protein attributes for C19orf57 Gene

    Size:
    668 amino acids
    Molecular mass:
    69556 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAB02340.1; Type=Erroneous translation; Note=Wrong choice of frame.; Evidence={ECO:0000305};

    Alternative splice isoforms for C19orf57 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for C19orf57 Gene

Post-translational modifications for C19orf57 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for C19orf57 Gene

Domains & Families for C19orf57 Gene

Gene Families for C19orf57 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for C19orf57 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for C19orf57 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with C19orf57: view

No data available for UniProtKB/Swiss-Prot for C19orf57 Gene

Function for C19orf57 Gene

Gene Ontology (GO) - Molecular Function for C19orf57 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0005515 protein binding IPI 16189514
genes like me logo Genes that share ontologies with C19orf57: view
genes like me logo Genes that share phenotypes with C19orf57: view

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for C19orf57 Gene

Localization for C19orf57 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for C19orf57 gene
Compartment Confidence
nucleus 4
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for C19orf57 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
genes like me logo Genes that share ontologies with C19orf57: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for C19orf57 Gene

Pathways & Interactions for C19orf57 Gene

SuperPathways for C19orf57 Gene

No Data Available

Gene Ontology (GO) - Biological Process for C19orf57 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007275 multicellular organism development NAS 8228263
genes like me logo Genes that share ontologies with C19orf57: view

No data available for Pathways by source and SIGNOR curated interactions for C19orf57 Gene

Drugs & Compounds for C19orf57 Gene

No Compound Related Data Available

Transcripts for C19orf57 Gene

Unigene Clusters for C19orf57 Gene

Chromosome 19 open reading frame 57:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for C19orf57 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10
SP1: - - -
SP2: - -
SP3: -
SP4:

Relevant External Links for C19orf57 Gene

GeneLoc Exon Structure for
C19orf57
ECgene alternative splicing isoforms for
C19orf57

Expression for C19orf57 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for C19orf57 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for C19orf57 Gene

This gene is overexpressed in Testis (x8.1).

Protein differential expression in normal tissues from HIPED for C19orf57 Gene

This gene is overexpressed in Liver (45.0) and Kidney (14.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for C19orf57 Gene



NURSA nuclear receptor signaling pathways regulating expression of C19orf57 Gene:

C19orf57

SOURCE GeneReport for Unigene cluster for C19orf57 Gene:

Hs.143288

Evidence on tissue expression from TISSUES for C19orf57 Gene

  • Lung(4.1)
genes like me logo Genes that share expression patterns with C19orf57: view

No data available for Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for C19orf57 Gene

Orthologs for C19orf57 Gene

This gene was present in the common ancestor of mammals.

Orthologs for C19orf57 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia C19H19orf57 33
  • 99.06 (n)
C19orf57 34
  • 94 (a)
OneToOne
dog
(Canis familiaris)
Mammalia C20H19orf57 33
  • 70.81 (n)
C19orf57 34
  • 55 (a)
OneToOne
cow
(Bos Taurus)
Mammalia C7H19orf57 33
  • 70.11 (n)
C19orf57 34
  • 50 (a)
OneToOne
mouse
(Mus musculus)
Mammalia 4930432K21Rik 16 34 33
  • 62.89 (n)
rat
(Rattus norvegicus)
Mammalia RGD1306072 33
  • 62.3 (n)
Species where no ortholog for C19orf57 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for C19orf57 Gene

ENSEMBL:
Gene Tree for C19orf57 (if available)
TreeFam:
Gene Tree for C19orf57 (if available)

Paralogs for C19orf57 Gene

No data available for Paralogs for C19orf57 Gene

Variants for C19orf57 Gene

Sequence variations from dbSNP and Humsavar for C19orf57 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1028125077 uncertain-significance, not provided 13,906,457(-) GGACCCCCGGGACCCCCGGG/GGACCCCCGGG upstream_transcript_variant
rs755038966 uncertain-significance, not specified 13,906,456(-) AGGACCCCC/AGGACCCCCAGGACCCCC upstream_transcript_variant
rs769120532 uncertain-significance, not specified 13,906,511(-) C/A/T upstream_transcript_variant
rs1000018074 -- 13,902,990(-) T/C intron_variant
rs1000199459 -- 13,883,530(-) G/A genic_downstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for C19orf57 Gene

Variant ID Type Subtype PubMed ID
esv2668513 CNV deletion 23128226
esv3643730 CNV loss 21293372
esv3643731 CNV loss 21293372
nsv833757 CNV loss 17160897
nsv833760 CNV loss 17160897
nsv953979 CNV deletion 24416366

Variation tolerance for C19orf57 Gene

Residual Variation Intolerance Score: 92.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.78; 91.65% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for C19orf57 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
C19orf57

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C19orf57 Gene

Disorders for C19orf57 Gene

Additional Disease Information for C19orf57

No disorders were found for C19orf57 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C19orf57 Gene

Publications for C19orf57 Gene

  1. Identification of human pre-T/NK cell-associated genes. (PMID: 8228263) Ranes-Goldberg MG … Spits H (Journal of immunology (Baltimore, Md. : 1950) 1993) 2 3 4 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  3. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  4. An inter-species protein-protein interaction network across vast evolutionary distance. (PMID: 27107014) Zhong Q … Vidal M (Molecular systems biology 2016) 3 58
  5. Widespread macromolecular interaction perturbations in human genetic disorders. (PMID: 25910212) Sahni N … Vidal M (Cell 2015) 3 58

Products for C19orf57 Gene

Sources for C19orf57 Gene

Content
Loading form....