Aliases for C16orf74 Gene

Aliases for C16orf74 Gene

  • Chromosome 16 Open Reading Frame 74 2 3 5
  • Uncharacterized Protein C16orf74 3 4
  • Hypothetical Protein 1 3
  • Hypothetical Protein 2 3
  • Hypothetical Protein 3 3

External Ids for C16orf74 Gene

Previous GeneCards Identifiers for C16orf74 Gene

  • GC16M084299
  • GC16M085741
  • GC16M071483
  • GC16M085726

Summaries for C16orf74 Gene

GeneCards Summary for C16orf74 Gene

C16orf74 (Chromosome 16 Open Reading Frame 74) is a Protein Coding gene.

Additional gene information for C16orf74 Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for C16orf74 Gene

Genomics for C16orf74 Gene

GeneHancer (GH) Regulatory Elements for C16orf74 Gene

Promoters and enhancers for C16orf74 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16J085749 Promoter/Enhancer 1.7 EPDnew FANTOM5 Ensembl ENCODE 753.2 -0.6 -605 4.3 SMARCE1 POLR2A MYC MAX ZNF148 SP7 SMARCA4 GLIS2 CREB1 ZIC2 C16orf74 lnc-C16orf74-1 lnc-C16orf74-2
GH16J085745 Promoter/Enhancer 1.3 EPDnew Ensembl ENCODE 756.1 +4.1 4128 4 GATA3 POLR2A ZNF217 ETV6 MNT RELA NCOA3 CBFA2T2 MYC CEBPG C16orf74 ENSG00000270184 RN7SL381P ZDHHC7 MTHFSD RNU1-103P ENSG00000269898 lnc-C16orf74-1
GH16J085798 Promoter/Enhancer 2 EPDnew Ensembl ENCODE CraniofacialAtlas 5.2 -48.4 -48410 3.9 SIN3A ZBTB40 MLX RBPJ POLR2A NR2F1 NR2F6 CREB1 HCFC1 MIXL1 COX4I1 EMC8 piR-59610 GSE1 MTHFSD RNU1-103P C16orf74
GH16J085718 Enhancer 0.7 ENCODE 12.2 +32.2 32219 0.2 CTCF SREBF1 USF2 MNT ZKSCAN8 IKZF1 DPF2 GTF2F1 MTA3 ZNF10 GINS2 C16orf74 RNU1-103P RF00017-2179 piR-57445 lnc-C16orf74-1
GH16J085690 Promoter 0.5 Ensembl 11.8 +60.6 60628 0.2 VEZF1 NFXL1 GINS2 C16orf74 ENSG00000275393 lnc-C16orf74-1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around C16orf74 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the C16orf74 gene promoter:
  • E47
  • IRF-7A
  • Nkx3-1
  • Nkx3-1 v1
  • Nkx3-1 v2
  • Nkx3-1 v3
  • Nkx3-1 v4
  • NRSF form 1
  • NRSF form 2
  • TBP

Genomic Locations for C16orf74 Gene

Genomic Locations for C16orf74 Gene
chr16:85,690,084-85,751,129
(GRCh38/hg38)
Size:
61,046 bases
Orientation:
Minus strand
chr16:85,723,690-85,784,735
(GRCh37/hg19)
Size:
61,046 bases
Orientation:
Minus strand

Genomic View for C16orf74 Gene

Genes around C16orf74 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C16orf74 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C16orf74 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C16orf74 Gene

Proteins for C16orf74 Gene

  • Protein details for C16orf74 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96GX8-CP074_HUMAN
    Recommended name:
    Uncharacterized protein C16orf74
    Protein Accession:
    Q96GX8

    Protein attributes for C16orf74 Gene

    Size:
    76 amino acids
    Molecular mass:
    8118 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BC009078; Type=Miscellaneous discrepancy; Note=Intron retention.; Evidence={ECO:0000305};

neXtProt entry for C16orf74 Gene

Post-translational modifications for C16orf74 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for C16orf74 Gene

No data available for DME Specific Peptides for C16orf74 Gene

Domains & Families for C16orf74 Gene

Gene Families for C16orf74 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for C16orf74 Gene

InterPro:
ProtoNet:
genes like me logo Genes that share domains with C16orf74: view

No data available for Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for C16orf74 Gene

Function for C16orf74 Gene

Phenotypes From GWAS Catalog for C16orf74 Gene

Gene Ontology (GO) - Molecular Function for C16orf74 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16189514
genes like me logo Genes that share ontologies with C16orf74: view
genes like me logo Genes that share phenotypes with C16orf74: view

Animal Model Products

CRISPR Products

miRNA for C16orf74 Gene

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for C16orf74

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for C16orf74 Gene

Localization for C16orf74 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for C16orf74 gene
Compartment Confidence
plasma membrane 2
extracellular 2
cytoskeleton 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Centrosome (2)
  • Plasma membrane (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for C16orf74 Gene

Pathways & Interactions for C16orf74 Gene

PathCards logo

SuperPathways for C16orf74 Gene

No Data Available

Interacting Proteins for C16orf74 Gene

Gene Ontology (GO) - Biological Process for C16orf74 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for C16orf74 Gene

Drugs & Compounds for C16orf74 Gene

No Compound Related Data Available

Transcripts for C16orf74 Gene

mRNA/cDNA for C16orf74 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for C16orf74

Alternative Splicing Database (ASD) splice patterns (SP) for C16orf74 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4a · 4b ^ 5
SP1: -
SP2: -
SP3: - - -

Relevant External Links for C16orf74 Gene

GeneLoc Exon Structure for
C16orf74
ECgene alternative splicing isoforms for
C16orf74

Expression for C16orf74 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for C16orf74 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for C16orf74 Gene

This gene is overexpressed in Bladder (x5.2).

Protein differential expression in normal tissues from HIPED for C16orf74 Gene

This gene is overexpressed in Placenta (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for C16orf74 Gene



Protein tissue co-expression partners for C16orf74 Gene

NURSA nuclear receptor signaling pathways regulating expression of C16orf74 Gene:

C16orf74

SOURCE GeneReport for Unigene cluster for C16orf74 Gene:

Hs.461655
genes like me logo Genes that share expression patterns with C16orf74: view

No data available for mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for C16orf74 Gene

Orthologs for C16orf74 Gene

This gene was present in the common ancestor of mammals.

Orthologs for C16orf74 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia C16H16orf74 32
  • 99.56 (n)
C16orf74 33
  • 99 (a)
OneToOne
dog
(Canis familiaris)
Mammalia C5H16orf74 32
  • 89.91 (n)
C16orf74 33
  • 86 (a)
OneToOne
cow
(Bos Taurus)
Mammalia C18H16orf74 32
  • 82.67 (n)
rat
(Rattus norvegicus)
Mammalia RGD1309651 32
  • 80 (n)
mouse
(Mus musculus)
Mammalia 1190005I06Rik 17 33 32
  • 79.39 (n)
Gm27021 33
  • 37 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia C16orf74 33
  • 71 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia C16orf74 33
  • 67 (a)
OneToOne
Species where no ortholog for C16orf74 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for C16orf74 Gene

ENSEMBL:
Gene Tree for C16orf74 (if available)
TreeFam:
Gene Tree for C16orf74 (if available)

Paralogs for C16orf74 Gene

No data available for Paralogs for C16orf74 Gene

Variants for C16orf74 Gene

Sequence variations from dbSNP and Humsavar for C16orf74 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs767753044 not-provided, not provided 85,710,233(-) CGTCCAGGTGCTTGTCGTTC/ coding_sequence_variant, frameshift, intron_variant, non_coding_transcript_variant
rs1000026284 -- 85,720,691(-) G/A/C intron_variant
rs1000037634 -- 85,725,390(-) T/C intron_variant
rs1000063495 -- 85,747,952(-) G/A intron_variant
rs1000093546 -- 85,720,968(-) G/A/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for C16orf74 Gene

Variant ID Type Subtype PubMed ID
dgv3060n100 CNV loss 25217958
esv1023256 CNV deletion 17803354
esv2714855 CNV deletion 23290073
esv3582420 CNV loss 25503493
esv4262 OTHER complex 18987735
nsv1116168 CNV deletion 24896259
nsv1138477 CNV deletion 24896259
nsv483044 CNV gain 15286789
nsv510693 CNV deletion 20534489
nsv527240 CNV loss 19592680
nsv833316 CNV loss 17160897
nsv952063 CNV deletion 24416366

Variation tolerance for C16orf74 Gene

Gene Damage Index Score: 1.39; 27.34% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for C16orf74 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
C16orf74

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C16orf74 Gene

Disorders for C16orf74 Gene

Additional Disease Information for C16orf74

No disorders were found for C16orf74 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C16orf74 Gene

Publications for C16orf74 Gene

  1. Molecular targeting of cell-permeable peptide inhibits pancreatic ductal adenocarcinoma cell proliferation. (PMID: 29371937) Sato S … Hirano S (Oncotarget 2017) 2 3 56
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
  3. Overexpression of C16orf74 is involved in aggressive pancreatic cancers. (PMID: 28881575) Nakamura T … Nakamura Y (Oncotarget 2017) 3 56
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T … Vidal M (Cell 2014) 3 56
  5. A small de novo 16q24.1 duplication in a woman with severe clinical features. (PMID: 23333879) Quéméner-Redon S … Férec C (European journal of medical genetics 2013) 3 56

Products for C16orf74 Gene

Sources for C16orf74 Gene