Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C12orf57 Gene

Aliases for C12orf57 Gene

  • Chromosome 12 Open Reading Frame 57 2 3 5
  • C10 3 4
  • Likely Ortholog Of Mouse Gene Rich Cluster, C10 3
  • Gene Rich Cluster C10 Gene 2
  • Gene Rich Cluster C10 3
  • Protein C10 3
  • GRCC10 3

External Ids for C12orf57 Gene

Previous GeneCards Identifiers for C12orf57 Gene

  • GC12P006927
  • GC12P006929
  • GC12P006932
  • GC12P006934
  • GC12P006937
  • GC12P006939
  • GC12P007053
  • GC12P007057
  • GC12P007059
  • GC12P007062
  • GC12P007094
  • GC12P007117
  • GC12P007150
  • GC12P007022
  • GC12P007082
  • GC12P007224
  • GC12P007273
  • GC12P007319
  • GC12P007368
  • GC12P007413
  • GC12P007457

Summaries for C12orf57 Gene

Entrez Gene Summary for C12orf57 Gene

  • This gene is ubiquitously expressed in human tissues. It is required for development of the human corpus callosum. Mutations in this gene are associated with Temtamy syndrome (TEMTYS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]

GeneCards Summary for C12orf57 Gene

C12orf57 (Chromosome 12 Open Reading Frame 57) is a Protein Coding gene. Diseases associated with C12orf57 include Temtamy Syndrome and Colobomatous Microphthalmia.

UniProtKB/Swiss-Prot for C12orf57 Gene

  • In brain, may be required for corpus callusum development.

Additional gene information for C12orf57 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C12orf57 Gene

Genomics for C12orf57 Gene

GeneHancer (GH) Regulatory Elements for C12orf57 Gene

Promoters and enhancers for C12orf57 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12J006940 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 650.4 +10.7 10680 25.9 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 PTPN6 C12orf57 EMG1 ZNF384 ENSG00000219410 ENSG00000247853 SPSB2 SCARNA12 NCAPD2 ENSG00000256967
GH12J006662 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 19.2 -279.8 -279751 2.2 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC ENSG00000219410 ING4 ACRBP ZNF384 CHD4 ENSG00000247853 ENSG00000126749 NCAPD2 SPSB2 SCARNA12
GH12J006762 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.8 -176.6 -176574 7.2 ZFP64 FEZF1 YY1 E2F8 ZNF143 SP3 NFYC MEF2D ZNF610 GLIS1 MLF2 PTMS ZNF384 ENSG00000219410 CHD4 ENSG00000247853 SPSB2 ENSG00000256967 ENSG00000126749 C1RL-AS1
GH12J006602 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.8 -337.3 -337250 7.4 HDGF PKNOX1 FOXA2 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 CHD4 ZNF384 ENSG00000219410 ENSG00000247853 NOP2 NCAPD2 ING4 SPSB2 ENSG00000126749 SCARNA12
GH12J006459 Enhancer 1.3 Ensembl ENCODE dbSUPER 19.1 -480.8 -480834 6.3 HDGF PKNOX1 ZFP64 IRF4 ZNF213 ZNF207 ZNF143 ATF7 RUNX3 ZNF202 ZNF384 ENSG00000219410 CHD4 ENSG00000247853 TAPBPL MRPL51 NOP2 SCARNA12 VAMP1 ENSG00000126749
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around C12orf57 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the C12orf57 gene promoter:

Genomic Locations for C12orf57 Gene

Genomic Locations for C12orf57 Gene
chr12:6,942,978-6,946,003
(GRCh38/hg38)
Size:
3,026 bases
Orientation:
Plus strand
chr12:7,052,141-7,055,166
(GRCh37/hg19)

Genomic View for C12orf57 Gene

Genes around C12orf57 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C12orf57 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C12orf57 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C12orf57 Gene

Proteins for C12orf57 Gene

  • Protein details for C12orf57 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q99622-C10_HUMAN
    Recommended name:
    Protein C10
    Protein Accession:
    Q99622
    Secondary Accessions:
    • B2R4Q6

    Protein attributes for C12orf57 Gene

    Size:
    126 amino acids
    Molecular mass:
    13178 Da
    Quaternary structure:
    No Data Available

neXtProt entry for C12orf57 Gene

Post-translational modifications for C12orf57 Gene

  • Ubiquitination at Lys86 and Lys80
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for C12orf57 Gene

Domains & Families for C12orf57 Gene

Gene Families for C12orf57 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for C12orf57 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for C12orf57 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q99622

UniProtKB/Swiss-Prot:

C10_HUMAN :
  • Belongs to the UPF0456 family.
Family:
  • Belongs to the UPF0456 family.
genes like me logo Genes that share domains with C12orf57: view

Function for C12orf57 Gene

Molecular function for C12orf57 Gene

UniProtKB/Swiss-Prot Function:
In brain, may be required for corpus callusum development.

Phenotypes From GWAS Catalog for C12orf57 Gene

Gene Ontology (GO) - Molecular Function for C12orf57 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with C12orf57: view
genes like me logo Genes that share phenotypes with C12orf57: view

Human Phenotype Ontology for C12orf57 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for C12orf57 Gene

MGI Knock Outs for C12orf57:
  • Grcc10 Grcc10<tm1.1(KOMP)Vlcg>

Animal Model Products

CRISPR Products

miRNA for C12orf57 Gene

miRTarBase miRNAs that target C12orf57

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for C12orf57

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for C12orf57 Gene

Localization for C12orf57 Gene

Subcellular locations from UniProtKB/Swiss-Prot for C12orf57 Gene

Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for C12orf57 gene
Compartment Confidence
cytosol 2
extracellular 1
mitochondrion 1
nucleus 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear speckles (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for C12orf57 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA,IDA 23453666
GO:0016607 nuclear speck IDA --
genes like me logo Genes that share ontologies with C12orf57: view

Pathways & Interactions for C12orf57 Gene

SuperPathways for C12orf57 Gene

No Data Available

Gene Ontology (GO) - Biological Process for C12orf57 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0009791 post-embryonic development IMP 23453665
GO:0014819 regulation of skeletal muscle contraction IMP 23453665
GO:0021540 corpus callosum morphogenesis IMP 23453665
GO:0021678 third ventricle development IMP 23453666
GO:0036343 psychomotor behavior IMP 23633300
genes like me logo Genes that share ontologies with C12orf57: view

No data available for Pathways by source and SIGNOR curated interactions for C12orf57 Gene

Drugs & Compounds for C12orf57 Gene

No Compound Related Data Available

Transcripts for C12orf57 Gene

mRNA/cDNA for C12orf57 Gene

(3) Selected AceView cDNA sequences:
(4) Additional mRNA sequences :
(5) REFSEQ mRNAs :
(7) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for C12orf57 Gene

Chromosome 12 open reading frame 57:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for C12orf57

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for C12orf57 Gene

ExUns: 1a · 1b ^ 2a · 2b · 2c · 2d ^ 3a · 3b
SP1: - -
SP2:
SP3:

Relevant External Links for C12orf57 Gene

GeneLoc Exon Structure for
C12orf57
ECgene alternative splicing isoforms for
C12orf57

Expression for C12orf57 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for C12orf57 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for C12orf57 Gene

This gene is overexpressed in Breast (15.1) and Bone (6.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for C12orf57 Gene



NURSA nuclear receptor signaling pathways regulating expression of C12orf57 Gene:

C12orf57

SOURCE GeneReport for Unigene cluster for C12orf57 Gene:

Hs.405913

mRNA Expression by UniProt/SwissProt for C12orf57 Gene:

Q99622-C10_HUMAN
Tissue specificity: Ubiquitously expressed, with higher expression in lung and fetal brain.

Evidence on tissue expression from TISSUES for C12orf57 Gene

  • Nervous system(4.8)
  • Lung(4.5)
  • Muscle(2.7)
  • Blood(2.5)
  • Intestine(2.4)
  • Heart(2.2)
  • Skin(2.2)
  • Stomach(2.1)
  • Gall bladder(2)
  • Kidney(2)
  • Liver(2)
  • Lymph node(2)
  • Thyroid gland(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for C12orf57 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • cardiovascular
  • integumentary
  • nervous
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • nose
  • outer ear
  • skull
  • tooth
Thorax:
  • aorta
Pelvis:
  • pelvis
Limb:
  • digit
  • femur
  • finger
  • foot
  • hand
  • hip
  • knee
  • lower limb
  • shin
  • thigh
  • tibia
  • toe
  • upper limb
General:
  • blood
  • blood vessel
  • hair
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with C12orf57: view

No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for C12orf57 Gene

Orthologs for C12orf57 Gene

This gene was present in the common ancestor of animals.

Orthologs for C12orf57 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia C12orf57 34
  • 100 (a)
OneToOne
C12H12orf57 33
  • 98.68 (n)
dog
(Canis familiaris)
Mammalia C12orf57 34
  • 97 (a)
OneToOne
C27H12orf57 33
  • 92.63 (n)
oppossum
(Monodelphis domestica)
Mammalia -- 34
  • 94 (a)
OneToMany
-- 34
  • 89 (a)
OneToMany
cow
(Bos Taurus)
Mammalia C5H12orf57 34 33
  • 89.97 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Grcc10 16 34 33
  • 88.62 (n)
chicken
(Gallus gallus)
Aves C12ORF57 34 33
  • 80.38 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia C12orf57 34
  • 75 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia c12orf57 33
  • 60.3 (n)
zebrafish
(Danio rerio)
Actinopterygii C20H12orf57 34
  • 72 (a)
OneToOne
grcc10 33
  • 70.4 (n)
wufc02g04 33
fruit fly
(Drosophila melanogaster)
Insecta CG15387 34
  • 31 (a)
OneToOne
Species where no ortholog for C12orf57 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for C12orf57 Gene

ENSEMBL:
Gene Tree for C12orf57 (if available)
TreeFam:
Gene Tree for C12orf57 (if available)

Paralogs for C12orf57 Gene

Pseudogenes.org Pseudogenes for C12orf57 Gene

genes like me logo Genes that share paralogs with C12orf57: view

No data available for Paralogs for C12orf57 Gene

Variants for C12orf57 Gene

Sequence variations from dbSNP and Humsavar for C12orf57 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs139068225 uncertain-significance, not specified, Temtamy syndrome 6,945,798(+) A/G coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs139938808 uncertain-significance, likely-benign, not specified, Temtamy syndrome 6,944,509(+) C/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs146024802 uncertain-significance, Temtamy syndrome 6,944,485(+) C/G/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs191711101 uncertain-significance, Temtamy syndrome 6,944,473(+) C/T 5_prime_UTR_variant, intron_variant, non_coding_transcript_variant
rs199730337 likely-benign, benign, not specified, Temtamy syndrome 6,944,655(+) GGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGG/GGGTCAGACGCGGGAAGGCGGG/GGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGGTCAGACGCGGGAAGGCGGG intron_variant

Structural Variations from Database of Genomic Variants (DGV) for C12orf57 Gene

Variant ID Type Subtype PubMed ID
dgv2324n54 CNV loss 21841781
esv5830 CNV gain 19470904
nsv1035811 CNV gain 25217958
nsv1047373 CNV gain 25217958
nsv509453 CNV insertion 20534489
nsv557262 CNV gain 21841781

Variation tolerance for C12orf57 Gene

Residual Variation Intolerance Score: 50.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.88; 18.28% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for C12orf57 Gene

Human Gene Mutation Database (HGMD)
C12orf57
SNPedia medical, phenotypic, and genealogical associations of SNPs for
C12orf57

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C12orf57 Gene

Disorders for C12orf57 Gene

MalaCards: The human disease database

(10) MalaCards diseases for C12orf57 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
temtamy syndrome
  • temtys
colobomatous microphthalmia
  • microphthalmia with colobomatous cyst
hydronephrosis
vesicoureteral reflux 1
  • vur1
attention deficit-hyperactivity disorder
  • adhd
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

C10_HUMAN
  • Temtamy syndrome (TEMTYS) [MIM:218340]: A mental retardation/multiple congenital anomaly syndrome characterized by variable craniofacial dysmorphism, ocular coloboma, seizures, and brain abnormalities, including abnormalities of the corpus callosum and thalamus. {ECO:0000269 PubMed:23453665, ECO:0000269 PubMed:23453666, ECO:0000269 PubMed:23633300}. Note=The disease is caused by mutations affecting the gene represented in this entry. A variant resulting in a GUG start codon may be able to produce some protein because of a consensus Kozak sequence, although less efficiently than the wild type. This would explain the phenotypic variability observed.

Additional Disease Information for C12orf57

genes like me logo Genes that share disorders with C12orf57: view

No data available for Genatlas for C12orf57 Gene

Publications for C12orf57 Gene

  1. Whole-exome sequencing identifies mutated c12orf57 in recessive corpus callosum hypoplasia. (PMID: 23453666) Akizu N … Gleeson JG (American journal of human genetics 2013) 2 3 4 58
  2. Mutations in c12orf57 cause a syndromic form of colobomatous microphthalmia. (PMID: 23453665) Zahrani F … Alkuraya FS (American journal of human genetics 2013) 2 3 4 58
  3. Exome sequencing identifies compound heterozygous mutations in C12orf57 in two siblings with severe intellectual disability, hypoplasia of the corpus callosum, chorioretinal coloboma, and intractable seizures. (PMID: 24798461) Platzer K … Kaiser FJ (American journal of medical genetics. Part A 2014) 2 3 58
  4. A newly recognized autosomal recessive syndrome affecting neurologic function and vision. (PMID: 23633300) Salih MA … Bosley TM (American journal of medical genetics. Part A 2013) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for C12orf57 Gene

Sources for C12orf57 Gene

Content
Loading form....