Free for academic non-profit institutions. Other users need a Commercial license

Aliases for C11orf96 Gene

Aliases for C11orf96 Gene

  • Chromosome 11 Open Reading Frame 96 2 3 5
  • Uncharacterized Protein C11orf96 3 4
  • Protein Ag2 Homolog 3 4
  • AG2 3 4

External Ids for C11orf96 Gene

Previous GeneCards Identifiers for C11orf96 Gene

  • GC11P043673

Summaries for C11orf96 Gene

GeneCards Summary for C11orf96 Gene

C11orf96 (Chromosome 11 Open Reading Frame 96) is a Protein Coding gene.

Additional gene information for C11orf96 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for C11orf96 Gene

Genomics for C11orf96 Gene

GeneHancer (GH) Regulatory Elements for C11orf96 Gene

Promoters and enhancers for C11orf96 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11J043917 Enhancer 1.4 Ensembl ENCODE dbSUPER 600.7 -1.8 -1839 12.2 ZKSCAN8 MNT CBFA2T2 ZNF148 MLLT1 CEBPG ZSCAN21 NCOA3 BACH1 MAFK C11orf96 ALKBH3 ALKBH3-AS1 ACCSL ENSG00000254409
GH11J043880 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 11.4 -44.2 -44241 2.2 ZNF652 SP1 CC2D1A ZFX ELF3 SIX5 NKRF CEBPG GTF2F1 ZNF687 ALKBH3 ENSG00000246250 LOC105376644 SEC14L1P1 ALKBH3-AS1 C11orf96 EXT2 ACCS ENSG00000255165 ACCSL
GH11J044065 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 10 +141.6 141606 3.3 CC2D1A SP1 ZFX NKRF MLLT1 ZNF121 GTF2F1 ZNF687 ZSCAN21 CTCF ACCS EXT2 C11orf96 ALKBH3-AS1 ENSG00000255165 GC11P043987
GH11J043868 Promoter/Enhancer 1.5 Ensembl ENCODE 10.7 -56.2 -56194 1.5 SP1 CC2D1A CBFA2T2 MLLT1 CEBPG GTF2F1 JUND SP7 TRIM24 RELA ALKBH3-AS1 C11orf96 HSD17B12 ALKBH3 MIR129-2 ENSG00000246250 ENSG00000283375
GH11J044036 Enhancer 1.1 Ensembl ENCODE dbSUPER 10.9 +112.0 111969 1 CC2D1A CTCF RAD21 RXRA ARID2 REST SP1 TRIM22 NRF1 ZBTB17 C11orf96 ALKBH3-AS1 ACCS GC11P043987 ACCSL
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around C11orf96 on UCSC Golden Path with GeneCards custom track

Genomic Locations for C11orf96 Gene

Genomic Locations for C11orf96 Gene
18,542 bases
Plus strand
18,997 bases
Plus strand

Genomic View for C11orf96 Gene

Genes around C11orf96 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
C11orf96 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for C11orf96 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for C11orf96 Gene

Proteins for C11orf96 Gene

  • Protein details for C11orf96 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Uncharacterized protein C11orf96
    Protein Accession:

    Protein attributes for C11orf96 Gene

    435 amino acids
    Molecular mass:
    46114 Da
    Quaternary structure:
    No Data Available

neXtProt entry for C11orf96 Gene

Post-translational modifications for C11orf96 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for C11orf96 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for C11orf96 Gene

Domains & Families for C11orf96 Gene

Gene Families for C11orf96 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for C11orf96 Gene


Suggested Antigen Peptide Sequences for C11orf96 Gene

GenScript: Design optimal peptide antigens:
  • Protein Ag2 homolog (CK096_HUMAN)

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with C11orf96: view

No data available for UniProtKB/Swiss-Prot for C11orf96 Gene

Function for C11orf96 Gene

Phenotypes From GWAS Catalog for C11orf96 Gene

Phenotypes for C11orf96 Gene

genes like me logo Genes that share phenotypes with C11orf96: view

Animal Model Products

CRISPR Products

miRNA for C11orf96 Gene

miRTarBase miRNAs that target C11orf96

Clone Products

  • Applied Biological Materials (abm): Clones for C11orf96 - Now 50% OFF >
  • * C11orf96 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * C11orf96 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for C11orf96 Gene

Localization for C11orf96 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for C11orf96 gene
Compartment Confidence
nucleus 2
cytosol 2
extracellular 1
mitochondrion 1
peroxisome 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Focal adhesion sites (2)
  • Nucleus (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for C11orf96 Gene

Pathways & Interactions for C11orf96 Gene

PathCards logo

SuperPathways for C11orf96 Gene

No Data Available

Interacting Proteins for C11orf96 Gene

Gene Ontology (GO) - Biological Process for C11orf96 Gene


No data available for Pathways by source and SIGNOR curated interactions for C11orf96 Gene

Drugs & Compounds for C11orf96 Gene

No Compound Related Data Available

Transcripts for C11orf96 Gene

mRNA/cDNA for C11orf96 Gene

(1) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(62) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Unigene Clusters for C11orf96 Gene

Chromosome 11 open reading frame 96:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for C11orf96 - Now 50% OFF >
  • * C11orf96 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * C11orf96 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for C11orf96 Gene

No ASD Table

Relevant External Links for C11orf96 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for C11orf96 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for C11orf96 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for C11orf96 Gene

This gene is overexpressed in Gallbladder (16.5), Liver, secretome (14.1), Heart (9.6), Testis (8.0), and Uterus (7.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for C11orf96 Gene

Protein tissue co-expression partners for C11orf96 Gene

NURSA nuclear receptor signaling pathways regulating expression of C11orf96 Gene:


SOURCE GeneReport for Unigene cluster for C11orf96 Gene:


Evidence on tissue expression from TISSUES for C11orf96 Gene

  • Lung(3)
  • Kidney(2.8)
genes like me logo Genes that share expression patterns with C11orf96: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for C11orf96 Gene

Orthologs for C11orf96 Gene

This gene was present in the common ancestor of chordates.

Orthologs for C11orf96 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia C15H11orf96 34
  • 96.42 (n)
(Mus musculus)
Mammalia Gm13889 17 34
  • 95.59 (n)
(Rattus norvegicus)
Mammalia RGD1564664 34
  • 93.66 (n)
(Gallus gallus)
Aves C5H11ORF96 34
  • 85.28 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100495977 34
  • 73.94 (n)
(Danio rerio)
Actinopterygii LOC100330987 34
  • 63.37 (n)
C25H11orf96 35
  • 54 (a)
Species where no ortholog for C11orf96 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chimpanzee (Pan troglodytes)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for C11orf96 Gene

Gene Tree for C11orf96 (if available)
Gene Tree for C11orf96 (if available)

Paralogs for C11orf96 Gene

No data available for Paralogs for C11orf96 Gene

Variants for C11orf96 Gene

Sequence variations from dbSNP and Humsavar for C11orf96 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1001008053 -- 43,942,692(+) C/A/G 5_prime_UTR_variant
rs1001133985 -- 43,943,298(+) CGCGCGTCCGCGGTCCGCGCG/CGCGCG 3_prime_UTR_variant
rs1001839895 -- 43,941,390(+) A/G upstream_transcript_variant
rs1002960909 -- 43,944,044(+) G/T downstream_transcript_variant
rs1003222335 -- 43,943,814(+) C/A 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for C11orf96 Gene

Variant ID Type Subtype PubMed ID
dgv1109n100 CNV gain 25217958
esv3626156 CNV gain 21293372
nsv832138 CNV gain 17160897

Variation tolerance for C11orf96 Gene

Gene Damage Index Score: 8.43; 85.64% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for C11orf96 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for C11orf96 Gene

Disorders for C11orf96 Gene

Additional Disease Information for C11orf96

No disorders were found for C11orf96 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for C11orf96 Gene

Publications for C11orf96 Gene

  1. An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. (PMID: 24275569) Bian Y … Zou H (Journal of proteomics 2014) 4 58
  2. Toward a comprehensive characterization of a human cancer cell phosphoproteome. (PMID: 23186163) Zhou H … Mohammed S (Journal of proteome research 2013) 4 58
  3. System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PMID: 21406692) Rigbolt KT … Blagoev B (Science signaling 2011) 4 58
  4. Human chromosome 11 DNA sequence and analysis including novel gene identification. (PMID: 16554811) Taylor TD … Sakaki Y (Nature 2006) 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 58

Products for C11orf96 Gene

Sources for C11orf96 Gene

Loading form....