Free for academic non-profit institutions. Other users need a Commercial license

Aliases for BSN Gene

Aliases for BSN Gene

  • Bassoon Presynaptic Cytomatrix Protein 2 3 5
  • Zinc Finger Protein 231 2 3 4
  • Neuronal Double Zinc Finger Protein 2 3
  • ZNF231 3 4
  • Bassoon (Presynaptic Cytomatrix Protein) 2
  • Protein Bassoon 3
  • KIAA0434 4

External Ids for BSN Gene

Previous HGNC Symbols for BSN Gene

  • ZNF231

Previous GeneCards Identifiers for BSN Gene

  • GC03P046613
  • GC03M048695
  • GC03P049447
  • GC03P049550
  • GC03P049566

Summaries for BSN Gene

Entrez Gene Summary for BSN Gene

  • Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]

GeneCards Summary for BSN Gene

BSN (Bassoon Presynaptic Cytomatrix Protein) is a Protein Coding gene. Diseases associated with BSN include Decubitus Ulcer and Chronic Ulcer Of Skin. Among its related pathways are Neuroscience. An important paralog of this gene is PCLO.

UniProtKB/Swiss-Prot for BSN Gene

  • Is thought to be involved in the organization of the cytomatrix at the nerve terminals active zone (CAZ) which regulates neurotransmitter release. Seems to act through binding to ERC2/CAST1. Essential in regulated neurotransmitter release from a subset of brain glutamatergic synapses. Involved in the formation of the retinal photoreceptor ribbon synapses (By similarity).

Additional gene information for BSN Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for BSN Gene

Genomics for BSN Gene

GeneHancer (GH) Regulatory Elements for BSN Gene

Promoters and enhancers for BSN Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03I049553 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 550.8 -0.4 -353 1.7 HDGF PKNOX1 ATF1 MLX ARNT ARID4B SIN3A DMAP1 YBX1 ZNF143 BSN BSN-AS2 APEH PIR41851 GC03P049421
GH03I049484 Enhancer 1.3 Ensembl ENCODE dbSUPER 10.5 -69.3 -69253 1.9 FOXA2 MLX ZFP64 ARID4B ZNF48 ZNF213 ZC3H11A REST ZNF623 PPARG AMT ENSG00000235236 ENSG00000230454 RBM6 QRICH1 RBM5 WDR6 IP6K2 ENSG00000223343 BSN-AS2
GH03I049670 Enhancer 1.1 Ensembl ENCODE 10.8 +117.0 117032 1.8 HDGF FOXA2 ZFP64 ARID4B SIN3A DMAP1 YY1 ZNF143 RUNX3 RXRA APEH AMT BSN-AS1 BSN BSN-AS2 CDHR4 UBA7 MST1 PIR32155 GC03P049421
GH03I049665 Enhancer 0.8 ENCODE 11.9 +111.5 111494 0.2 ELF3 SOX13 TFAP4 SAP130 MLX ARID4B MAX RAD21 THRB RARA BSN-AS1 BSN BSN-AS2 PIR32155 APEH GC03P049421
GH03I049666 Enhancer 0.8 ENCODE 11.9 +112.0 112018 0.8 ELF3 MLX ARID4B RAD21 THRB RARA ETS1 CREM THAP11 MIXL1 BSN-AS1 BSN BSN-AS2 CDHR4 AMT PIR32155 APEH GC03P049421
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around BSN on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the BSN gene promoter:

Genomic Locations for BSN Gene

Genomic Locations for BSN Gene
chr3:49,554,489-49,671,549
(GRCh38/hg38)
Size:
117,061 bases
Orientation:
Plus strand
chr3:49,591,922-49,708,982
(GRCh37/hg19)

Genomic View for BSN Gene

Genes around BSN on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
BSN Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for BSN Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for BSN Gene

Proteins for BSN Gene

  • Protein details for BSN Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9UPA5-BSN_HUMAN
    Recommended name:
    Protein bassoon
    Protein Accession:
    Q9UPA5
    Secondary Accessions:
    • O43161
    • Q7LGH3

    Protein attributes for BSN Gene

    Size:
    3926 amino acids
    Molecular mass:
    416469 Da
    Quaternary structure:
    • Interacts with ERC2/CAST1, RIMS1 and UNC13A. Part of a complex consisting of ERC2, RIMS1 and BSN (By similarity).

neXtProt entry for BSN Gene

Post-translational modifications for BSN Gene

  • Myristoylated. The N-terminal myristoylation is not sufficient for presynaptic localization (By similarity).
  • Glycosylation at posLast=13431343, posLast=13841384, Thr2314, Thr2691, and Thr2936
  • Modification sites at PhosphoSitePlus

Other Protein References for BSN Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for BSN Gene

Domains & Families for BSN Gene

Gene Families for BSN Gene

HGNC:
Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for BSN Gene

Suggested Antigen Peptide Sequences for BSN Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with BSN: view

No data available for UniProtKB/Swiss-Prot for BSN Gene

Function for BSN Gene

Molecular function for BSN Gene

GENATLAS Biochemistry:
Bassoon,presynaptic cytomatrix protein,overexpressed in cerebella of patients with multiple system atrophy (MSA) potential transcriptional regulator
UniProtKB/Swiss-Prot Function:
Is thought to be involved in the organization of the cytomatrix at the nerve terminals active zone (CAZ) which regulates neurotransmitter release. Seems to act through binding to ERC2/CAST1. Essential in regulated neurotransmitter release from a subset of brain glutamatergic synapses. Involved in the formation of the retinal photoreceptor ribbon synapses (By similarity).

Phenotypes From GWAS Catalog for BSN Gene

Gene Ontology (GO) - Molecular Function for BSN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with BSN: view
genes like me logo Genes that share phenotypes with BSN: view

Animal Models for BSN Gene

MGI Knock Outs for BSN:

Animal Model Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for BSN Gene

Localization for BSN Gene

Subcellular locations from UniProtKB/Swiss-Prot for BSN Gene

Cytoplasm. Cell junction, synapse, synaptosome. Cytoplasm, cytoskeleton. Note=Localized to the active zone of presynaptic density. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for BSN gene
Compartment Confidence
cytoskeleton 5
nucleus 5
plasma membrane 2
cytosol 2
extracellular 1

Gene Ontology (GO) - Cellular Components for BSN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus TAS 9806829
GO:0005737 cytoplasm IEA --
GO:0005856 cytoskeleton IEA --
GO:0009986 cell surface IEA --
GO:0014069 postsynaptic density IEA --
genes like me logo Genes that share ontologies with BSN: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for BSN Gene

Pathways & Interactions for BSN Gene

SuperPathway Contained pathways
1 Neuroscience
genes like me logo Genes that share pathways with BSN: view

Pathways by source for BSN Gene

1 Cell Signaling Technology pathway for BSN Gene

Gene Ontology (GO) - Biological Process for BSN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007268 chemical synaptic transmission TAS 10329005
GO:0007416 synapse assembly IEA --
GO:0035418 protein localization to synapse IEA --
GO:0099526 presynapse to nucleus signaling pathway IEA --
genes like me logo Genes that share ontologies with BSN: view

No data available for SIGNOR curated interactions for BSN Gene

Drugs & Compounds for BSN Gene

No Compound Related Data Available

Transcripts for BSN Gene

mRNA/cDNA for BSN Gene

(1) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(99) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for BSN Gene

Bassoon presynaptic cytomatrix protein:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for BSN Gene

No ASD Table

Relevant External Links for BSN Gene

GeneLoc Exon Structure for
BSN
ECgene alternative splicing isoforms for
BSN

Expression for BSN Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for BSN Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for BSN Gene

This gene is overexpressed in Brain - Cortex (x6.7), Brain - Cerebellum (x6.5), Brain - Cerebellar Hemisphere (x6.4), Brain - Frontal Cortex (BA9) (x6.3), and Brain - Anterior cingulate cortex (BA24) (x5.4).

Protein differential expression in normal tissues from HIPED for BSN Gene

This gene is overexpressed in Frontal cortex (48.9) and Brain (16.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for BSN Gene



Protein tissue co-expression partners for BSN Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of BSN Gene:

BSN

SOURCE GeneReport for Unigene cluster for BSN Gene:

Hs.194684

mRNA Expression by UniProt/SwissProt for BSN Gene:

Q9UPA5-BSN_HUMAN
Tissue specificity: Exclusively expressed in brain.

Evidence on tissue expression from TISSUES for BSN Gene

  • Nervous system(4.9)
  • Eye(2.6)
genes like me logo Genes that share expression patterns with BSN: view

Primer Products

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for BSN Gene

Orthologs for BSN Gene

This gene was present in the common ancestor of animals.

Orthologs for BSN Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia BSN 33 34
  • 99.13 (n)
dog
(Canis familiaris)
Mammalia BSN 33 34
  • 88.26 (n)
cow
(Bos Taurus)
Mammalia BSN 33 34
  • 86.87 (n)
mouse
(Mus musculus)
Mammalia Bsn 33 16 34
  • 86.4 (n)
rat
(Rattus norvegicus)
Mammalia Bsn 33
  • 86.29 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 74 (a)
OneToMany
-- 34
  • 67 (a)
OneToMany
-- 34
  • 66 (a)
OneToMany
-- 34
  • 53 (a)
OneToMany
-- 34
  • 35 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia BSN 34
  • 66 (a)
OneToOne
chicken
(Gallus gallus)
Aves BSN 33 34
  • 66.53 (n)
lizard
(Anolis carolinensis)
Reptilia BSN 34
  • 60 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia bsn 33
  • 60.05 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC100004063 33
  • 54.26 (n)
BSN (3 of 3) 34
  • 49 (a)
OneToMany
BSN (1 of 3) 34
  • 48 (a)
OneToMany
BSN (2 of 3) 34
  • 45 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea F45E4.3 34
  • 21 (a)
OneToMany
Species where no ortholog for BSN was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for BSN Gene

ENSEMBL:
Gene Tree for BSN (if available)
TreeFam:
Gene Tree for BSN (if available)

Paralogs for BSN Gene

Paralogs for BSN Gene

genes like me logo Genes that share paralogs with BSN: view

Variants for BSN Gene

Sequence variations from dbSNP and Humsavar for BSN Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs759806020 uncertain-significance, Oromandibular-limb hypogenesis spectrum 49,656,922(+) CAGCAGCTGCAGCAGCAGCTGCAGCAGCAGCT/CAGCAGCTGCAGCAGCAGCT/CAGCAGCTGCAGCAGCAGCTGCAGCAGCAGCTGCAGCAGCAGCT coding_sequence_variant, inframe_deletion, inframe_insertion
rs1000003523 -- 49,613,670(+) /C intron_variant
rs1000036682 -- 49,670,913(+) C/T 3_prime_UTR_variant
rs1000118009 -- 49,644,590(+) G/T intron_variant
rs1000132681 -- 49,606,583(+) G/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for BSN Gene

Variant ID Type Subtype PubMed ID
esv1436359 CNV insertion 17803354
esv3415508 CNV insertion 20981092
esv3561863 CNV deletion 23714750
nsv1011428 CNV gain 25217958
nsv1072257 CNV deletion 25765185
nsv1123649 CNV deletion 24896259
nsv237379 CNV insertion 16902084
nsv3812 CNV deletion 18451855
nsv475870 CNV novel sequence insertion 20440878
nsv508217 CNV deletion 20534489
nsv834687 CNV loss 17160897

Variation tolerance for BSN Gene

Residual Variation Intolerance Score: 0.434% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.08; 80.41% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for BSN Gene

Human Gene Mutation Database (HGMD)
BSN
SNPedia medical, phenotypic, and genealogical associations of SNPs for
BSN

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for BSN Gene

Disorders for BSN Gene

MalaCards: The human disease database

(2) MalaCards diseases for BSN Gene - From: HGMD and DISEASES

Disorder Aliases PubMed IDs
decubitus ulcer
  • bedsore
chronic ulcer of skin
  • chronic wounds
- elite association - COSMIC cancer census association via MalaCards
Search BSN in MalaCards View complete list of genes associated with diseases

Additional Disease Information for BSN

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with BSN: view

No data available for UniProtKB/Swiss-Prot and Genatlas for BSN Gene

Publications for BSN Gene

  1. The presynaptic cytomatrix protein Bassoon: sequence and chromosomal localization of the human BSN gene. (PMID: 10329005) Winter C … Gundelfinger ED (Genomics 1999) 2 3 4 22 58
  2. Cloning and mapping of ZNF231, a novel brain-specific gene encoding neuronal double zinc finger protein whose expression is enhanced in a neurodegenerative disorder, multiple system atrophy (MSA). (PMID: 9806829) Hashida H … Sakaki Y (Genomics 1998) 2 3 4 22 58
  3. Identification of neuroglycan C and interacting partners as potential susceptibility genes for schizophrenia in a Southern Chinese population. (PMID: 19367581) So HC … Sham PC (American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2010) 3 44 58
  4. Variants at the 3p21 locus influence susceptibility and phenotype both in adults and early-onset patients with inflammatory bowel disease. (PMID: 20024904) Latiano A … Annese V (Inflammatory bowel diseases 2010) 3 44 58
  5. Association of linear growth impairment in pediatric Crohn's disease and a known height locus: a pilot study. (PMID: 20846217) Lee JJ … Hirschhorn J (Annals of human genetics 2010) 3 44 58

Products for BSN Gene

Sources for BSN Gene

Content
Loading form....