Free for academic non-profit institutions. Other users need a Commercial license

Aliases for BLVRA Gene

Aliases for BLVRA Gene

  • Biliverdin Reductase A 2 3 3 5
  • Biliverdin-IX Alpha-Reductase 3 4
  • BVR A 3 4
  • BLVR 3 4
  • BVR 3 4
  • Testis Tissue Sperm-Binding Protein Li 61n 3
  • EC 1.3.1.24 4
  • BVRA 3

External Ids for BLVRA Gene

Previous HGNC Symbols for BLVRA Gene

  • BLVR

Previous GeneCards Identifiers for BLVRA Gene

  • GC07P043444
  • GC07P043539
  • GC07P043571
  • GC07P043764
  • GC07P043683

Summaries for BLVRA Gene

Entrez Gene Summary for BLVRA Gene

  • The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]

GeneCards Summary for BLVRA Gene

BLVRA (Biliverdin Reductase A) is a Protein Coding gene. Diseases associated with BLVRA include Hyperbiliverdinemia and Petroclival Meningioma. Among its related pathways are Porphyrin and chlorophyll metabolism and Metabolism. Gene Ontology (GO) annotations related to this gene include oxidoreductase activity and biliverdin reductase activity.

UniProtKB/Swiss-Prot for BLVRA Gene

  • Reduces the gamma-methene bridge of the open tetrapyrrole, biliverdin IX alpha, to bilirubin with the concomitant oxidation of a NADH or NADPH cofactor.

Additional gene information for BLVRA Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for BLVRA Gene

Genomics for BLVRA Gene

GeneHancer (GH) Regulatory Elements for BLVRA Gene

Promoters and enhancers for BLVRA Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07J043757 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 664 +0.7 706 1.9 CLOCK ARID4B SIN3A DMAP1 ZNF48 ZNF121 GLIS2 KLF7 RUNX3 SP3 BLVRA STK17A ENSG00000229497 LOC102724946
GH07J043756 Enhancer 1.1 FANTOM5 ENCODE 662.9 -1.4 -1368 1.3 PKNOX1 ARNT FEZF1 IRF4 TCF12 FOS ATF7 RUNX3 JUNB NCOA1 BLVRA PIR57316 LOC102724946
GH07J043734 Enhancer 1.2 Ensembl ENCODE 28.9 -22.6 -22601 2.4 PKNOX1 ATF1 ARNT IRF4 GTF3C2 TCF12 POLR2B ZNF766 ATF7 RUNX3 PIR57316 BLVRA DDX56 TMED4 COA1 STK17A POLM ENSG00000228434 MRPL32 LINC00957
GH07J043728 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 14.1 -28.6 -28556 2.5 CLOCK SMAD1 ARNT ARID4B SIN3A DMAP1 ZNF2 IRF4 YY1 POLR2B COA1 DDX56 ENSG00000228434 POLM STK17A BLVRA SPDYE1 TMED4 LINC00957 GC07M043624
GH07J043642 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 15.8 -110.4 -110410 10.4 HDGF PKNOX1 SIN3A IRF4 BRCA1 ETS1 ATF7 FOS RUNX3 DEK STK17A COA1 BLVRA TMED4 DDX56 ENSG00000241057 DBNL POLM GC07M043624
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around BLVRA on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the BLVRA gene promoter:

Genomic Locations for BLVRA Gene

Genomic Locations for BLVRA Gene
chr7:43,758,192-43,807,342
(GRCh38/hg38)
Size:
49,151 bases
Orientation:
Plus strand
chr7:43,798,272-43,846,941
(GRCh37/hg19)

Genomic View for BLVRA Gene

Genes around BLVRA on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
BLVRA Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for BLVRA Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for BLVRA Gene

Proteins for BLVRA Gene

  • Protein details for BLVRA Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P53004-BIEA_HUMAN
    Recommended name:
    Biliverdin reductase A
    Protein Accession:
    P53004
    Secondary Accessions:
    • A8K747
    • O95019
    • Q86UX0
    • Q96QL4
    • Q9BRW8

    Protein attributes for BLVRA Gene

    Size:
    296 amino acids
    Molecular mass:
    33428 Da
    Cofactor:
    Name=Zn(2+); Xref=ChEBI:CHEBI:29105;
    Quaternary structure:
    • Monomer.
    Miscellaneous:
    • Uses the reactants NADH or NADPH depending on the pH; NADH is used at the acidic pH range (6-6.9) and NADPH at the alkaline range (8.5-8.7). NADPH, however, is the probable reactant in biological systems.

    Three dimensional structures from OCA and Proteopedia for BLVRA Gene

neXtProt entry for BLVRA Gene

Post-translational modifications for BLVRA Gene

  • Ubiquitination at posLast=261261, Lys253, posLast=234234, and posLast=219219
  • Modification sites at PhosphoSitePlus

Other Protein References for BLVRA Gene

No data available for DME Specific Peptides for BLVRA Gene

Domains & Families for BLVRA Gene

Gene Families for BLVRA Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted intracellular proteins

Protein Domains for BLVRA Gene

Suggested Antigen Peptide Sequences for BLVRA Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P53004

UniProtKB/Swiss-Prot:

BIEA_HUMAN :
  • Belongs to the Gfo/Idh/MocA family. Biliverdin reductase subfamily.
Family:
  • Belongs to the Gfo/Idh/MocA family. Biliverdin reductase subfamily.
genes like me logo Genes that share domains with BLVRA: view

Function for BLVRA Gene

Molecular function for BLVRA Gene

UniProtKB/Swiss-Prot Function:
Reduces the gamma-methene bridge of the open tetrapyrrole, biliverdin IX alpha, to bilirubin with the concomitant oxidation of a NADH or NADPH cofactor.
UniProtKB/Swiss-Prot CatalyticActivity:
Bilirubin + NAD(P)(+) = biliverdin + NAD(P)H.
GENATLAS Biochemistry:
biliverdin reductase IX alpha,22kDa,expressed in adult liver

Enzyme Numbers (IUBMB) for BLVRA Gene

Gene Ontology (GO) - Molecular Function for BLVRA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004074 biliverdin reductase activity TAS --
GO:0005515 protein binding IPI 18463290
GO:0008270 zinc ion binding IEA --
GO:0016491 oxidoreductase activity IBA,IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with BLVRA: view
genes like me logo Genes that share phenotypes with BLVRA: view

Human Phenotype Ontology for BLVRA Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

  • Taconic Biosciences Mouse Models for BLVRA

Clone Products

No data available for Phenotypes From GWAS Catalog , Animal Models , Transcription Factor Targets and HOMER Transcription for BLVRA Gene

Localization for BLVRA Gene

Subcellular locations from UniProtKB/Swiss-Prot for BLVRA Gene

Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for BLVRA gene
Compartment Confidence
extracellular 5
cytosol 5
mitochondrion 2
nucleus 2

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for BLVRA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol TAS,IDA --
GO:0070062 extracellular exosome HDA 19056867
genes like me logo Genes that share ontologies with BLVRA: view

Pathways & Interactions for BLVRA Gene

genes like me logo Genes that share pathways with BLVRA: view

Pathways by source for BLVRA Gene

1 BioSystems pathway for BLVRA Gene
3 Reactome pathways for BLVRA Gene
1 Qiagen pathway for BLVRA Gene

UniProtKB/Swiss-Prot P53004-BIEA_HUMAN

  • Pathway: Porphyrin-containing compound metabolism; protoheme degradation.

SIGNOR curated interactions for BLVRA Gene

Activates:

Gene Ontology (GO) - Biological Process for BLVRA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0042167 heme catabolic process TAS 10858451
GO:0055114 oxidation-reduction process IDA,IEA 10858451
genes like me logo Genes that share ontologies with BLVRA: view

Drugs & Compounds for BLVRA Gene

(13) Drugs for BLVRA Gene - From: DrugBank, ClinicalTrials, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
NADH Approved Nutra Target 0
biliverdin Experimental Pharma 0
Antibodies Pharma 7224
Hepatitis C Antibodies Pharma 63
Immunoglobulins Pharma 7224

(8) Additional Compounds for BLVRA Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
nadph
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide
  • 2'-(Dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) adenosine 5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosylnicotinamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) p'-5'-ester with 1,4-dihydro-1-beta-D-ribofuranosyl-3-pyridinecarboxamide
  • Adenosine 5'-(trihydrogen diphosphate) 2'-(dihydrogen phosphate) p'-5'-ester with 1,4-dihydro-1-beta-delta-ribofuranosyl-3-pyridinecarboxamide
  • b-NADPH
53-57-6
Formyl-CoA
  • Formyl coenzyme A
  • Formyl-coenzyme A
13131-49-2
Hydrogen Ion
  • H+
  • H(+)
  • Hydrogen cation
  • Hydron
  • Proton
NADP
  • beta-Nicotinamide adenine dinucleotide phosphate
  • NADP+
  • Nicotinamide adenine dinucleotide phosphate
  • Oxidized nicotinamide-adenine dinucleotide phosphate
  • TPN
53-59-8
genes like me logo Genes that share compounds with BLVRA: view

Transcripts for BLVRA Gene

Unigene Clusters for BLVRA Gene

Biliverdin reductase A:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for BLVRA Gene

No ASD Table

Relevant External Links for BLVRA Gene

GeneLoc Exon Structure for
BLVRA
ECgene alternative splicing isoforms for
BLVRA

Expression for BLVRA Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for BLVRA Gene

Protein differential expression in normal tissues from HIPED for BLVRA Gene

This gene is overexpressed in Spleen (10.2) and Breast (6.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for BLVRA Gene



Protein tissue co-expression partners for BLVRA Gene

NURSA nuclear receptor signaling pathways regulating expression of BLVRA Gene:

BLVRA

SOURCE GeneReport for Unigene cluster for BLVRA Gene:

Hs.488143

mRNA Expression by UniProt/SwissProt for BLVRA Gene:

P53004-BIEA_HUMAN
Tissue specificity: Liver.

Evidence on tissue expression from TISSUES for BLVRA Gene

  • Nervous system(4.7)
  • Liver(4.4)
  • Muscle(4.4)
  • Heart(2.4)
  • Lung(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for BLVRA Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • digestive
  • immune
  • integumentary
  • nervous
Regions:
Head and neck:
  • eye
  • head
  • mouth
Abdomen:
  • abdominal wall
  • biliary tract
  • gallbladder
  • liver
  • pancreas
General:
  • skin
genes like me logo Genes that share expression patterns with BLVRA: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for BLVRA Gene

Orthologs for BLVRA Gene

This gene was present in the common ancestor of chordates.

Orthologs for BLVRA Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia BLVRA 33
  • 100 (n)
dog
(Canis familiaris)
Mammalia BLVRA 34 33
  • 88.96 (n)
OneToOne
cow
(Bos Taurus)
Mammalia BLVRA 34 33
  • 88.74 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Blvra 33
  • 83.62 (n)
mouse
(Mus musculus)
Mammalia Blvra 16 34 33
  • 83.05 (n)
oppossum
(Monodelphis domestica)
Mammalia BLVRA 34
  • 64 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia BLVRA 34
  • 62 (a)
OneToOne
chicken
(Gallus gallus)
Aves BLVRA 34 33
  • 62.53 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia BLVRA 34
  • 57 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia blvra 33
  • 59.85 (n)
zebrafish
(Danio rerio)
Actinopterygii blvra 34 33
  • 58.02 (n)
OneToOne
Species where no ortholog for BLVRA was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for BLVRA Gene

ENSEMBL:
Gene Tree for BLVRA (if available)
TreeFam:
Gene Tree for BLVRA (if available)
Aminode:
Evolutionary constrained regions (ECRs) for BLVRA: view image

Paralogs for BLVRA Gene

No data available for Paralogs for BLVRA Gene

Variants for BLVRA Gene

Sequence variations from dbSNP and Humsavar for BLVRA Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs387906595 pathogenic, Hyperbiliverdinemia 43,787,943(+) C/G/T coding_sequence_variant, missense_variant, stop_gained
rs387906596 pathogenic, Hyperbiliverdinemia 43,788,022(+) C/A/G/T coding_sequence_variant, missense_variant, stop_gained
rs1000046450 -- 43,758,754(+) CGGGGGTCGCGCGCAGGGGAGCGGGGGTCGCGCGC/CGGGGGTCGCGCGC genic_upstream_transcript_variant, intron_variant
rs1000091063 -- 43,763,135(+) G/A genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000226265 -- 43,785,659(+) G/A intron_variant

Structural Variations from Database of Genomic Variants (DGV) for BLVRA Gene

Variant ID Type Subtype PubMed ID
nsv464441 CNV loss 19166990
nsv606745 CNV loss 21841781

Variation tolerance for BLVRA Gene

Residual Variation Intolerance Score: 83.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.01; 37.01% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for BLVRA Gene

Human Gene Mutation Database (HGMD)
BLVRA
SNPedia medical, phenotypic, and genealogical associations of SNPs for
BLVRA

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for BLVRA Gene

Disorders for BLVRA Gene

MalaCards: The human disease database

(9) MalaCards diseases for BLVRA Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
hyperbiliverdinemia
  • hblvd
petroclival meningioma
nodular malignant melanoma
  • nodular melanoma
pneumothorax
skull base neoplasm
  • tumors of skull base
- elite association - COSMIC cancer census association via MalaCards
Search BLVRA in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

BIEA_HUMAN
  • Hyperbiliverdinemia (HBLVD) [MIM:614156]: A condition characterized by a green discoloration of the skin, urine, serum, and other bodily fluids. It is due to increased biliverdin resulting from inefficient conversion to bilirubin. Affected individuals appear to have symptoms only in the context of obstructive cholestasis and/or liver failure. In some cases, green jaundice can resolve after resolution of obstructive cholestasis. {ECO:0000269 PubMed:19580635}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for BLVRA

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with BLVRA: view

No data available for Genatlas for BLVRA Gene

Publications for BLVRA Gene

  1. A novel mutation in the biliverdin reductase-A gene combined with liver cirrhosis results in hyperbiliverdinaemia (green jaundice). (PMID: 19580635) Gåfvels M … Stål P (Liver international : official journal of the International Association for the Study of the Liver 2009) 3 4 22 58
  2. Association of polymorphisms in four bilirubin metabolism genes with serum bilirubin in three Asian populations. (PMID: 19243019) Lin R … Jin L (Human mutation 2009) 3 22 44 58
  3. Common variants of four bilirubin metabolism genes and their association with serum bilirubin and coronary artery disease in Chinese Han population. (PMID: 19238116) Lin R … Jin L (Pharmacogenetics and genomics 2009) 3 22 44 58
  4. Human biliverdin IXalpha reductase is a zinc-metalloprotein. Characterization of purified and Escherichia coli expressed enzymes. (PMID: 8631357) Maines MD … McCoubrey WK (European journal of biochemistry 1996) 3 4 22 58
  5. Cloning and characterization of the cDNA encoding human biliverdin-IX alpha reductase. (PMID: 8950184) Komuro A … Tomita M (Biochimica et biophysica acta 1996) 3 4 22 58

Products for BLVRA Gene

Sources for BLVRA Gene

Content
Loading form....