Aliases for BISPR Gene

Subcategory (RNA class) for BISPR Gene

lncRNA

Quality Score for this RNA gene is

15

Aliases for BISPR Gene

  • BST2 Interferon Stimulated Positive Regulator 2 3 5
  • BST2 Interferon Stimulated Positive Regulator (Non-Protein Coding) 2 3
  • BISPR 2 170
  • BST2 IFN-Stimulated Positive Regulator 3
  • CTD-2521M24.9 3
  • HSALNG0124521 169
  • NONHSAG025088 94
  • LncBST2 3

External Ids for BISPR Gene

Previous GeneCards Identifiers for BISPR Gene

  • GC19P017551
  • GC19P017705
  • GC19P020522
  • GC19P020665
  • GC19P017730
  • GC19P018350
  • GC19P018733
  • GC19P019045
  • GC19P019362
  • GC19P019697
  • GC19P020074
  • GC19P020381

Summaries for BISPR Gene

GeneCards Summary for BISPR Gene

BISPR (BST2 Interferon Stimulated Positive Regulator) is an RNA Gene, and is affiliated with the lncRNA class.

Additional gene information for BISPR Gene

No data available for Entrez Gene Summary , CIViC Summary , UniProtKB/Swiss-Prot Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for BISPR Gene

Genomics for BISPR Gene

GeneHancer (GH) Regulatory Elements for BISPR Gene

Promoters and enhancers for BISPR Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around BISPR on UCSC Golden Path with GeneCards custom track

Genomic Locations for BISPR Gene

Genomic Locations for BISPR Gene
chr19:17,405,685-17,420,130
(GRCh38/hg38)
Size:
14,446 bases
Orientation:
Plus strand
chr19:16,148,246-16,148,278
(GRCh37/hg19)
Size:
33 bases
Orientation:
Plus strand

Genomic View for BISPR Gene

Genes around BISPR on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
BISPR Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for BISPR Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for BISPR Gene

Proteins for BISPR Gene

No data available for DME Specific Peptides for BISPR Gene

Domains & Families for BISPR Gene

Gene Families for BISPR Gene

genes like me logo Genes that share domains with BISPR: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences , Graphical View of Domain Structure and UniProtKB/Swiss-Prot for BISPR Gene

Function for BISPR Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for BISPR Gene

Localization for BISPR Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for BISPR Gene

Pathways & Interactions for BISPR Gene

PathCards logo

SuperPathways for BISPR Gene

No Data Available

Gene Ontology (GO) - Biological Process for BISPR Gene

None

No data available for Pathways by source and SIGNOR curated interactions for BISPR Gene

Drugs & Compounds for BISPR Gene

No Compound Related Data Available

Transcripts for BISPR Gene

mRNA/cDNA for BISPR Gene

(2) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(18) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
(47) RNACentral transcripts :
(49) LNCipedia transcripts :
(38) LncBook transcripts :
(14) NONCODE transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for BISPR Gene

No ASD Table

Relevant External Links for BISPR Gene

GeneLoc Exon Structure for
BISPR
ECgene alternative splicing isoforms for
BISPR

Expression for BISPR Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for BISPR Gene

NURSA nuclear receptor signaling pathways regulating expression of BISPR Gene:

BISPR
genes like me logo Genes that share expression patterns with BISPR: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for BISPR Gene

Orthologs for BISPR Gene

Evolution for BISPR Gene

ENSEMBL:
Gene Tree for BISPR (if available)
TreeFam:
Gene Tree for BISPR (if available)

No data available for Orthologs for BISPR Gene

Paralogs for BISPR Gene

No data available for Paralogs for BISPR Gene

Variants for BISPR Gene

Sequence variations from dbSNP and Humsavar for BISPR Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1555734052 association, Human immunodeficiency virus type 1, rapid progression to AIDS 17,406,018(+) GGGCCTG/GGGCCTGAGTCTGGGGGCGGGGCCTG intron_variant
rs1000157410 -- 17,408,539(+) G/A/T intron_variant
rs1000906895 -- 17,406,000(+) C/G/T intron_variant
rs1000937391 -- 17,406,221(+) C/G/T non_coding_transcript_variant
rs1001013922 -- 17,412,837(+) C/T intron_variant

Additional Variant Information for BISPR Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
BISPR

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for BISPR Gene

Disorders for BISPR Gene

Additional Disease Information for BISPR

No disorders were found for BISPR Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for BISPR Gene

Publications for BISPR Gene

  1. LncRNA BISPR promotes the progression of thyroid papillary carcinoma by regulating miR-21-5p. (PMID: 29856242) Zhang H … Jiang N (International journal of immunopathology and pharmacology 2018) 2 3 56
  2. Long Non-Coding RNA BST2/BISPR is Induced by IFN and Regulates the Expression of the Antiviral Factor Tetherin. (PMID: 25620967) Barriocanal M … Fortes P (Frontiers in immunology 2014) 2 3 56
  3. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 56
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 56

Products for BISPR Gene

Sources for BISPR Gene