Free for academic non-profit institutions. Other users need a Commercial license

Aliases for BICDL2 Gene

Aliases for BICDL2 Gene

  • BICD Family Like Cargo Adaptor 2 2 3 5
  • Coiled-Coil Domain-Containing Protein 64B 3 4
  • Coiled-Coil Domain Containing 64B 2 3
  • Bicaudal D-Related Protein 2 3 4
  • BICD-Related Protein 2 3 4
  • CCDC64B 3 4
  • BICDR-2 3 4
  • BICDR2 3 4
  • BICD Family-Like Cargo Adapter 2 3

External Ids for BICDL2 Gene

Previous HGNC Symbols for BICDL2 Gene

  • CCDC64B

Summaries for BICDL2 Gene

GeneCards Summary for BICDL2 Gene

BICDL2 (BICD Family Like Cargo Adaptor 2) is a Protein Coding gene. An important paralog of this gene is BICDL1.

Additional gene information for BICDL2 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for BICDL2 Gene

Genomics for BICDL2 Gene

GeneHancer (GH) Regulatory Elements for BICDL2 Gene

Promoters and enhancers for BICDL2 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16J003035 Promoter/Enhancer 1.3 EPDnew Ensembl ENCODE 650.7 +0.7 692 2.1 SMARCE1 MAZ SIN3A ELF1 KLF4 ZNF664 ZSCAN16 POLR2A EZH2 GC16M003037 BICDL2 LOC100128770 NLRC3
GH16J003037 Enhancer 0.7 ENCODE 650.7 -1.4 -1408 0.9 BCOR SOX13 ZNF792 ZNF493 MAX ZMYM3 CEBPG ZFHX2 POLR2A SCRT2 GC16M003037 GC16M003041 PIR32172 BICDL2 LOC100128770 ZNF213-AS1 TSC2 ZNF75A TIGD7 ERVK13-1
GH16J003038 Enhancer 0.5 ENCODE 650.7 -2.0 -1992 0.2 BCOR ZFP69B ZFHX2 ZNF692 ZNF140 ZNF24 BICDL2 GC16M003037 GC16M003041 PIR32172 ZNF75A ENSG00000261938 ZNF263 ERVK13-1 TSC2 SNHG19
GH16J003019 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 30.2 +14.7 14660 5.2 MLX DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF416 ZNF143 SP3 NFYC THOC6 HCFC1R1 TNFRSF12A ZNF263 ENSG00000261938 SRRM2 E4F1 CREBBP TSC2 ERVK13-1
GH16J003017 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 24.9 +19.0 19048 1.8 ATF1 SIN3A RAD21 ETS1 ZNF143 ATF7 CREM THAP11 SP5 REST CLDN6 TNFRSF12A PKMYT1 BICDL2 ENSG00000272079 CLDN9
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around BICDL2 on UCSC Golden Path with GeneCards custom track

Genomic Locations for BICDL2 Gene

Genomic Locations for BICDL2 Gene
9,282 bases
Minus strand
9,245 bases
Minus strand

Genomic View for BICDL2 Gene

Genes around BICDL2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
BICDL2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for BICDL2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for BICDL2 Gene

Proteins for BICDL2 Gene

  • Protein details for BICDL2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    BICD family-like cargo adapter 2
    Protein Accession:
    Secondary Accessions:
    • Q658L9

    Protein attributes for BICDL2 Gene

    508 amino acids
    Molecular mass:
    56834 Da
    Quaternary structure:
    • Interacts with RAB13.

    Alternative splice isoforms for BICDL2 Gene


neXtProt entry for BICDL2 Gene

Post-translational modifications for BICDL2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for BICDL2 Gene

No data available for DME Specific Peptides for BICDL2 Gene

Domains & Families for BICDL2 Gene

Gene Families for BICDL2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for BICDL2 Gene


Suggested Antigen Peptide Sequences for BICDL2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the BICDR family.
  • Belongs to the BICDR family.
genes like me logo Genes that share domains with BICDL2: view

Function for BICDL2 Gene

Phenotypes From GWAS Catalog for BICDL2 Gene

Gene Ontology (GO) - Molecular Function for BICDL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25416956
GO:0017137 Rab GTPase binding IEA --
genes like me logo Genes that share ontologies with BICDL2: view

Phenotypes for BICDL2 Gene

genes like me logo Genes that share phenotypes with BICDL2: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for BICDL2

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for BICDL2 Gene

Localization for BICDL2 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for BICDL2 gene
Compartment Confidence
nucleus 3
cytosol 3
cytoskeleton 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Actin filaments (2)
  • Cytosol (2)
  • Intermediate filaments (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for BICDL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IBA --
genes like me logo Genes that share ontologies with BICDL2: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for BICDL2 Gene

Pathways & Interactions for BICDL2 Gene

SuperPathways for BICDL2 Gene

No Data Available

Interacting Proteins for BICDL2 Gene

Gene Ontology (GO) - Biological Process for BICDL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0047496 vesicle transport along microtubule IBA --
GO:0055107 Golgi to secretory granule transport IBA --
genes like me logo Genes that share ontologies with BICDL2: view

No data available for Pathways by source and SIGNOR curated interactions for BICDL2 Gene

Drugs & Compounds for BICDL2 Gene

No Compound Related Data Available

Transcripts for BICDL2 Gene

mRNA/cDNA for BICDL2 Gene

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for BICDL2

Alternative Splicing Database (ASD) splice patterns (SP) for BICDL2 Gene

No ASD Table

Relevant External Links for BICDL2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for BICDL2 Gene

NURSA nuclear receptor signaling pathways regulating expression of BICDL2 Gene:


Evidence on tissue expression from TISSUES for BICDL2 Gene

  • Stomach(4.2)
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for BICDL2 Gene

Orthologs for BICDL2 Gene

This gene was present in the common ancestor of animals.

Orthologs for BICDL2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CCDC64B 34 33
  • 99.34 (n)
(Canis familiaris)
Mammalia CCDC64B 34 33
  • 86.34 (n)
(Bos Taurus)
Mammalia CCDC64B 34 33
  • 85.08 (n)
(Rattus norvegicus)
Mammalia Ccdc64b 33
  • 82.21 (n)
(Mus musculus)
Mammalia Ccdc64b 34 33
  • 80.96 (n)
Bicdl2 16
(Monodelphis domestica)
Mammalia CCDC64B 34
  • 72 (a)
(Ornithorhynchus anatinus)
Mammalia CCDC64B 34
  • 56 (a)
(Anolis carolinensis)
Reptilia CCDC64B 34
  • 42 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ccdc64b 33
  • 50.47 (n)
(Danio rerio)
Actinopterygii CCDC64B 34
  • 15 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG32137 34
  • 22 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 30 (a)
CSA.2341 34
  • 18 (a)
Species where no ortholog for BICDL2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for BICDL2 Gene

Gene Tree for BICDL2 (if available)
Gene Tree for BICDL2 (if available)
Evolutionary constrained regions (ECRs) for BICDL2: view image

Paralogs for BICDL2 Gene

Paralogs for BICDL2 Gene

genes like me logo Genes that share paralogs with BICDL2: view

Variants for BICDL2 Gene

Sequence variations from dbSNP and Humsavar for BICDL2 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs1000024355 -- 3,036,078(-) C/T genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000028770 -- 3,032,511(-) C/T genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000308899 -- 3,036,969(-) C/T 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant
rs1000447187 -- 3,032,401(-) C/T genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000525687 -- 3,036,758(-) CCGGCGCCCCCGGTTCCCCGGCG/CCGGCG genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for BICDL2 Gene

Variant ID Type Subtype PubMed ID
esv2763127 CNV loss 21179565
esv3637645 CNV gain 21293372
nsv509588 CNV insertion 20534489
nsv510673 CNV deletion 20534489
nsv571248 CNV loss 21841781
nsv833125 CNV loss 17160897
nsv952906 CNV deletion 24416366

Variation tolerance for BICDL2 Gene

Gene Damage Index Score: 15.77; 97.35% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for BICDL2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for BICDL2 Gene

Disorders for BICDL2 Gene

No disorders were found for BICDL2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for BICDL2 Gene

Publications for BICDL2 Gene

  1. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T … Vidal M (Cell 2014) 3 58
  2. The full-ORF clone resource of the German cDNA Consortium. (PMID: 17974005) Bechtel S … Schupp I (BMC genomics 2007) 4 58
  3. Large-scale analysis of the human ubiquitin-related proteome. (PMID: 16196087) Matsumoto M … Nakayama KI (Proteomics 2005) 3 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 58
  5. The sequence and analysis of duplication-rich human chromosome 16. (PMID: 15616553) Martin J … Pennacchio LA (Nature 2004) 4 58

Products for BICDL2 Gene

Sources for BICDL2 Gene

Loading form....