Free for academic non-profit institutions. Other users need a Commercial license

Aliases for BEAN1 Gene

Aliases for BEAN1 Gene

  • Brain Expressed Associated With NEDD4 1 2 3 5
  • Brain-Expressed Protein Associating With Nedd4 Homolog 3 4
  • BEAN 3 4
  • Spinocerebellar Ataxia 31 2
  • Protein BEAN1 3
  • SCA31 3

External Ids for BEAN1 Gene

Previous HGNC Symbols for BEAN1 Gene

  • SCA31

Previous GeneCards Identifiers for BEAN1 Gene

  • GC16P052336

Summaries for BEAN1 Gene

Entrez Gene Summary for BEAN1 Gene

  • The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]

GeneCards Summary for BEAN1 Gene

BEAN1 (Brain Expressed Associated With NEDD4 1) is a Protein Coding gene. Diseases associated with BEAN1 include Spinocerebellar Ataxia 31.

Additional gene information for BEAN1 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for BEAN1 Gene

Genomics for BEAN1 Gene

GeneHancer (GH) Regulatory Elements for BEAN1 Gene

Promoters and enhancers for BEAN1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16J066427 Promoter 1.5 EPDnew Ensembl 650.7 +0.0 4 0.6 KLF1 ZNF777 ZBTB6 L3MBTL2 SUZ12 SIN3A GLI4 KLF14 ZNF335 ZFHX2 BEAN1 ENSG00000260146
GH16J066476 Promoter/Enhancer 1.1 EPDnew ENCODE 650.2 +50.0 50013 1.8 BCOR PKNOX1 ZMYM3 EBF1 MEF2B POLR2A ZNF239 ZFP36 BEAN1 TK2 BEAN1-AS1 GC16M066468 PIR55464 ENSG00000260851
GH16J066442 Promoter 0.5 EPDnew 650.4 +14.8 14753 0.1 BEAN1 ENSG00000260146
GH16J066547 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 25.1 +123.8 123754 6.6 MLX ZFP64 DMAP1 YY1 SLC30A9 E2F8 ZNF416 ZNF143 SP3 NFYC TK2 CKLF CKLF-CMTM1 ENSG00000261519 ENSG00000275745 PIR51465 PIR54425 NAE1 ZDHHC1 BEAN1
GH16J066510 Enhancer 1.4 Ensembl ENCODE dbSUPER 33.2 +84.9 84870 3.8 PKNOX1 FOXA2 ARID4B SIN3A ETS1 YY1 TCF12 ELK1 ATF7 FOS PIR49300 PIR55233 GC16M066512 BEAN1 TK2 BEAN1-AS1 CKLF CKLF-CMTM1 CMTM2 CES4A
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around BEAN1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for BEAN1 Gene

Genomic Locations for BEAN1 Gene
chr16:66,427,297-66,493,529
(GRCh38/hg38)
Size:
66,233 bases
Orientation:
Plus strand
chr16:66,460,816-66,527,432
(GRCh37/hg19)
Size:
66,617 bases
Orientation:
Plus strand

Genomic View for BEAN1 Gene

Genes around BEAN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
BEAN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for BEAN1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for BEAN1 Gene

Proteins for BEAN1 Gene

  • Protein details for BEAN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q3B7T3-BEAN1_HUMAN
    Recommended name:
    Protein BEAN1
    Protein Accession:
    Q3B7T3
    Secondary Accessions:
    • B3KPC0
    • H3BP97

    Protein attributes for BEAN1 Gene

    Size:
    259 amino acids
    Molecular mass:
    28626 Da
    Quaternary structure:
    • Interacts with NEDD4.
    SequenceCaution:
    • Sequence=AAI07478.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=EG328447; Type=Frameshift; Positions=79; Evidence={ECO:0000305};

    Alternative splice isoforms for BEAN1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for BEAN1 Gene

Post-translational modifications for BEAN1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for BEAN1 Gene

Domains & Families for BEAN1 Gene

Gene Families for BEAN1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for BEAN1 Gene

ProtoNet:

Suggested Antigen Peptide Sequences for BEAN1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with BEAN1: view

No data available for UniProtKB/Swiss-Prot for BEAN1 Gene

Function for BEAN1 Gene

Phenotypes From GWAS Catalog for BEAN1 Gene

genes like me logo Genes that share phenotypes with BEAN1: view

Human Phenotype Ontology for BEAN1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for BEAN1 Gene

MGI Knock Outs for BEAN1:

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Transcription Factor Targets and HOMER Transcription for BEAN1 Gene

Localization for BEAN1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for BEAN1 Gene

Membrane; Single-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for BEAN1 gene
Compartment Confidence
extracellular 2
nucleus 2
plasma membrane 1
mitochondrion 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Centrosome (1)
  • Nucleoplasm (1)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for BEAN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with BEAN1: view

Pathways & Interactions for BEAN1 Gene

SuperPathways for BEAN1 Gene

No Data Available

Interacting Proteins for BEAN1 Gene

STRING Interaction Network Preview (showing 2 interactants - click image to see details)
http://version10.5.string-db.org/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000442793%0d%0a9606.ENSP00000358081%0d%0a9606.ENSP00000429084%0d%0a
Selected Interacting proteins: Q3B7T3-BEAN1_HUMAN ENSP00000442793 for BEAN1 Gene via IID STRING

Gene Ontology (GO) - Biological Process for BEAN1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for BEAN1 Gene

Drugs & Compounds for BEAN1 Gene

No Compound Related Data Available

Transcripts for BEAN1 Gene

Unigene Clusters for BEAN1 Gene

Brain expressed, associated with NEDD4, 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for BEAN1 Gene

No ASD Table

Relevant External Links for BEAN1 Gene

GeneLoc Exon Structure for
BEAN1
ECgene alternative splicing isoforms for
BEAN1

Expression for BEAN1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for BEAN1 Gene

mRNA differential expression in normal tissues according to GTEx for BEAN1 Gene

This gene is overexpressed in Brain - Cerebellum (x4.3) and Brain - Cerebellar Hemisphere (x4.2).

NURSA nuclear receptor signaling pathways regulating expression of BEAN1 Gene:

BEAN1

SOURCE GeneReport for Unigene cluster for BEAN1 Gene:

Hs.97805

Evidence on tissue expression from TISSUES for BEAN1 Gene

  • Nervous system(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for BEAN1 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • nervous
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • cerebellum
  • head
Limb:
  • lower limb
  • upper limb
General:
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with BEAN1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for BEAN1 Gene

Orthologs for BEAN1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for BEAN1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia BEAN1 34
  • 98 (a)
OneToOne
cow
(Bos Taurus)
Mammalia BEAN1 34 33
  • 85.1 (n)
OneToOne
dog
(Canis familiaris)
Mammalia BEAN1 34 33
  • 84.57 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Bean1 33
  • 82.82 (n)
mouse
(Mus musculus)
Mammalia Bean1 16 34 33
  • 80.62 (n)
chicken
(Gallus gallus)
Aves BEAN1 34
  • 36 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii BEAN1 34
  • 29 (a)
OneToOne
Species where no ortholog for BEAN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for BEAN1 Gene

ENSEMBL:
Gene Tree for BEAN1 (if available)
TreeFam:
Gene Tree for BEAN1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for BEAN1: view image

Paralogs for BEAN1 Gene

(22) SIMAP similar genes for BEAN1 Gene using alignment to 3 proteins:

  • BEAN1_HUMAN
  • H3BRW1_HUMAN
  • J3KRN6_HUMAN
genes like me logo Genes that share paralogs with BEAN1: view

No data available for Paralogs for BEAN1 Gene

Variants for BEAN1 Gene

Sequence variations from dbSNP and Humsavar for BEAN1 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs1000060942 -- 66,484,827(+) C/T genic_downstream_transcript_variant, intron_variant
rs1000097500 -- 66,458,993(+) C/T genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000174711 -- 66,483,441(+) G/A genic_downstream_transcript_variant, intron_variant
rs1000209837 -- 66,435,170(+) G/T genic_upstream_transcript_variant, intron_variant
rs1000223966 -- 66,434,207(+) CCCCGACCCCGACCCCAACCCCGACCCCGACCCC/CCCCGACCCCGACCCC/CCCCGACCCCGACCCCAACCCCGACCCCGACCCCAACCCCGACCCCGACCCC genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for BEAN1 Gene

Variant ID Type Subtype PubMed ID
nsv833264 CNV gain 17160897
nsv827705 CNV gain 20364138
nsv1838 CNV insertion 18451855
nsv1118356 CNV deletion 24896259
esv3638870 CNV loss 21293372
esv3638869 CNV loss 21293372
esv2714644 CNV deletion 23290073
esv2672892 CNV deletion 23128226
esv2661454 CNV deletion 23128226

Variation tolerance for BEAN1 Gene

Gene Damage Index Score: 1.91; 35.65% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for BEAN1 Gene

Human Gene Mutation Database (HGMD)
BEAN1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
BEAN1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for BEAN1 Gene

Disorders for BEAN1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for BEAN1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
spinocerebellar ataxia 31
  • sca31
- elite association - COSMIC cancer census association via MalaCards
Search BEAN1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

BEAN1_HUMAN
  • Spinocerebellar ataxia 31 (SCA31) [MIM:117210]: A form of spinocerebellar ataxia, a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA31 belongs to the autosomal dominant cerebellar ataxias type III (ADCA III) which are characterized by pure cerebellar ataxia without additional signs. {ECO:0000269 PubMed:19878914}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for BEAN1

genes like me logo Genes that share disorders with BEAN1: view

No data available for Genatlas for BEAN1 Gene

Publications for BEAN1 Gene

  1. Abnormal RNA structures (RNA foci) containing a penta-nucleotide repeat (UGGAA)n in the Purkinje cell nucleus is associated with spinocerebellar ataxia type 31 pathogenesis. (PMID: 23607545) Niimi Y … Ishikawa K (Neuropathology : official journal of the Japanese Society of Neuropathology 2013) 2 3 58
  2. Spinocerebellar ataxia type 31 is associated with "inserted" penta-nucleotide repeats containing (TGGAA)n. (PMID: 19878914) Sato N … Mizusawa H (American journal of human genetics 2009) 3 4 58
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  4. Identification of multiple proteins expressed in murine embryos as binding partners for the WW domains of the ubiquitin-protein ligase Nedd4. (PMID: 11042109) Jolliffe CN … Kumar S (The Biochemical journal 2000) 2 3 58
  5. A "double adaptor" method for improved shotgun library construction. (PMID: 8619474) Andersson B … Gibbs RA (Analytical biochemistry 1996) 2 3 58

Products for BEAN1 Gene

Sources for BEAN1 Gene

Content
Loading form....