Aliases for AXIN1 Gene
Aliases for AXIN1 Gene
External Ids for AXIN1 Gene
- HGNC: 903
- Entrez Gene: 8312
- Ensembl: ENSG00000103126
- OMIM: 603816
- UniProtKB: O15169
Previous GeneCards Identifiers for AXIN1 Gene
- GC16M000356
- GC16M000277
Summaries for AXIN1 Gene
-
This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
GeneCards Summary for AXIN1 Gene
AXIN1 (Axin 1) is a Protein Coding gene. Diseases associated with AXIN1 include Caudal Duplication Anomaly and Hepatocellular Carcinoma. Among its related pathways are phosphorylation site mutants of CTNNB1 are not targeted to the proteasome by the destruction complex and Reelin Pathway (Cajal-Retzius cells). Gene Ontology (GO) annotations related to this gene include protein homodimerization activity and protein kinase binding. An important paralog of this gene is AXIN2.
UniProtKB/Swiss-Prot for AXIN1 Gene
-
Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling (PubMed:12192039, PubMed:27098453). Controls dorsoventral patterning via two opposing effects; down-regulates CTNNB1 to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway (PubMed:12192039). In Wnt signaling, probably facilitates the phosphorylation of CTNNB1 and APC by GSK3B (PubMed:12192039). Likely to function as a tumor suppressor. Enhances TGF-beta signaling by recruiting the RNF111 E3 ubiquitin ligase and promoting the degradation of inhibitory SMAD7 (PubMed:16601693). Also component of the AXIN1-HIPK2-TP53 complex which controls cell growth, apoptosis and development (PubMed:17210684). Facilitates the phosphorylation of TP53 by HIPK2 upon ultraviolet irradiation (PubMed:17210684).
Additional gene information for AXIN1 Gene
- Monarch Initiative
- Search for AXIN1 at DataMed
- Search for AXIN1 at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AXIN1 Gene
Genomics for AXIN1 Gene
GeneHancer (GH) Regulatory Elements for AXIN1 Gene
Promoters and enhancers for AXIN1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around AXIN1 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the AXIN1 gene promoter:
Regulatory Element Products
Genomic Locations for AXIN1 Gene
Genomic Locations for AXIN1 Gene
- chr16:287,440-361,497
- (GRCh38/hg38)
- Size:
- 74,058 bases
- Orientation:
- Minus strand
- chr16:337,440-402,676
- (GRCh37/hg19)
Genomic View for AXIN1 Gene
Genes around AXIN1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 16p13.3 by Entrez Gene
- 16p13.3 by HGNC
- 16p13.3 by Ensembl
AXIN1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for AXIN1 Gene
Proteins for AXIN1 Gene
-
Protein details for AXIN1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- O15169-AXIN1_HUMAN
- Recommended name:
- Axin-1
- Protein Accession:
- O15169
- Q4TT26
- Q4TT27
- Q86YA7
- Q8WVW6
- Q96S28
Protein attributes for AXIN1 Gene
- Size:
- 862 amino acids
- Molecular mass:
- 95635 Da
- Quaternary structure:
-
- Homodimer. Interacts with ZBED3; the interaction is direct, enhanced by protein kinase GSK3B and casein kinase CSNK1E activities and decreases GSK3B-induced beta-catenin serine and threonine phosphorylations (By similarity). Component of the beta-catenin destruction complex, containing at least, CTNNB1, an axin and GSK3B, that regulates CTNNB1 protein levels through phosphorylation and ubiquitination. Interacts with CTNNB1 (via the armadillo repeats 2-7). Interacts with GSK3B; the interaction hyperphosphorylates CTNNB1 leading to its ubiquitination and destruction (PubMed:17318175, PubMed:12554650). Component of the AXIN1-HIPK2-TP53 complex (PubMed:17210684). Interacts directly in the complex with TP53 and HIPK2 (PubMed:17210684). Interacts with DAXX; the interaction stimulates the interaction of DAXX with TP53, stimulates Ser-46 phosphorylation of TP53 and induces cell death on UV irradiation (PubMed:17210684). Also binds APC, SMAD6, SMAD7 and RNF111 (PubMed:16601693, PubMed:10811618). Interacts with DIXDC1; prevents interaction with MAP3K1 (PubMed:15262978). Interacts with MAP3K4 (PubMed:15262978). Interacts with ANKRD6 and AIDA (By similarity). Interacts with MDFI; the interaction decreases AXIN1-mediated JUN N-terminal kinase (JNK) activation (PubMed:12192039). Interacts with MDFIC; the interaction inhibits beta-cateninin-mediated signaling and AXIN1-mediated JUN N-terminal kinase (JNK) activation (PubMed:12192039). Interacts with LRP5 (via its phosphorylated PPPSP motifs); the interaction is stimulated by WNT1 and GSK3B and activates beta-catenin signaling (PubMed:11336703). Interacts (via the C-terminal) with PPP1CA; the interaction dephosphorylates AXIN1 and regulates interaction with GSK3B (PubMed:9920888). Interacts with PPP2CA; the interaction dephosphorylates AXIN1 (PubMed:9920888). Interacts with MACF1 (By similarity). Found in a complex composed of MACF1, APC, AXIN1, CTNNB1 and GSK3B (By similarity). Interacts with TNKS (PubMed:19759537, PubMed:21478859, PubMed:21799911). Interacts with DAB2; the interaction is mutually exclusive with the AXIN1:PPP1CA interaction (PubMed:12805222). Interacts with WDR26 (PubMed:27098453).
- SequenceCaution:
-
- Sequence=AAC51624.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};
Three dimensional structures from OCA and Proteopedia for AXIN1 Gene
Protein Expression for AXIN1 Gene
Post-translational modifications for AXIN1 Gene
- Phosphorylation and dephosphorylation of AXIN1 regulates assembly and function of the beta-catenin complex. Phosphorylated by CK1 and GSK3B. Dephosphorylated by PPP1CA and PPP2CA. Phosphorylation by CK1 enhances binding of GSK3B to AXIN1.
- ADP-ribosylated by tankyrase TNKS and TNKS2. Poly-ADP-ribosylated protein is recognized by RNF146, followed by ubiquitination at Lys-48 and subsequent activation of the Wnt signaling pathway.
- Ubiquitinated by RNF146 when poly-ADP-ribosylated, leading to its degradation and subsequent activation of the Wnt signaling pathway. Sumoylation at Lys-857 and Lys-860 prevents ubiquitination and degradation. Sumoylation is required for AXIN1-mediated JNK activation. Deubiquitinated by USP34, deubiquitinated downstream of beta-catenin stabilization step: deubiquitination is important for nuclear accumulation during Wnt signaling to positively regulate beta-catenin (CTNBB1)-mediated transcription.
- Modification sites at PhosphoSitePlus
- Modification sites at neXtProt
Other Protein References for AXIN1 Gene
Antibody Products
- R&D Systems Antibodies for AXIN1 (Axin-1)
-
Custom Antibody ServicesOriGene Antibodies for AXIN1
- Novus Biologicals Antibodies for AXIN1
- Invitrogen Antibodies for AXIN1
- GeneTex AXIN1 Antibody for AXIN1
-
Custom Antibody ServicesProSci Antibodies for AXIN1
-
Santa Cruz Biotechnology (SCBT) Antibodies for AXIN1
Protein Products
-
OriGene Purified Proteins for AXIN1
- Search Origene for MassSpec and Protein Over-expression Lysates for AXIN1
- Origene Custom Protein Services for AXIN1
- Search GeneTex for Proteins for AXIN1
Assay Products
No data available for DME Specific Peptides for AXIN1 Gene
Domains & Families for AXIN1 Gene
Gene Families for AXIN1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Cancer-related genes
- Disease related genes
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for AXIN1 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for AXIN1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
O15169UniProtKB/Swiss-Prot:
AXIN1_HUMAN :- The tankyrase-binding motif (also named TBD) is required for interaction with tankyrase TNKS and TNKS2.
- Domain:
-
- The tankyrase-binding motif (also named TBD) is required for interaction with tankyrase TNKS and TNKS2.
Function for AXIN1 Gene
Molecular function for AXIN1 Gene
- UniProtKB/Swiss-Prot Function:
- Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling (PubMed:12192039, PubMed:27098453). Controls dorsoventral patterning via two opposing effects; down-regulates CTNNB1 to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway (PubMed:12192039). In Wnt signaling, probably facilitates the phosphorylation of CTNNB1 and APC by GSK3B (PubMed:12192039). Likely to function as a tumor suppressor. Enhances TGF-beta signaling by recruiting the RNF111 E3 ubiquitin ligase and promoting the degradation of inhibitory SMAD7 (PubMed:16601693). Also component of the AXIN1-HIPK2-TP53 complex which controls cell growth, apoptosis and development (PubMed:17210684). Facilitates the phosphorylation of TP53 by HIPK2 upon ultraviolet irradiation (PubMed:17210684).
- GENATLAS Biochemistry:
- axin 1,ubiquitously expressed (in mouse),negative regulator of the Wnt signaling pathway,promoting the GSK3B dependent phosphorylation of beta catenin CTNNB1
Phenotypes From GWAS Catalog for AXIN1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0004871 | obsolete signal transducer activity | IDA | -- |
| GO:0005096 | GTPase activator activity | IBA | -- |
| GO:0005515 | protein binding | IPI | 9601641 |
| GO:0008013 | beta-catenin binding | IDA | 10644691 |
| GO:0019899 | enzyme binding | IPI | 19759537 |
Phenotypes for AXIN1 Gene
- MGI mutant phenotypes for AXIN1:
-
inferred from 10 alleles
- cardiovascular system phenotype
- respiratory system phenotype
- limbs/digits/tail phenotype
- digestive/alimentary phenotype
- nervous system phenotype
- behavior/neurological phenotype
- mortality/aging
- cellular phenotype
- craniofacial phenotype
- reproductive system phenotype
- skeleton phenotype
- embryo phenotype
- normal phenotype
- hearing/vestibular/ear phenotype
- renal/urinary system phenotype
- growth/size/body region phenotype
- GenomeRNAi human phenotypes for AXIN1:
Animal Models for AXIN1 Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for AXIN1
-
CRISPR Products
-
OriGene CRISPR knockouts for AXIN1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AXIN1
- genomics-online: gRNA clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
- Applied Biological Materials CRISPR for AXIN1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for AXIN1
- GenScript: Design CRISPR guide RNA sequences for AXIN1
miRNA for AXIN1 Gene
- miRTarBase miRNAs that target AXIN1
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for AXIN1
- Browse OriGene Inhibitory RNA Products For AXIN1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AXIN1
- genomics-online: shRNA clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
Clone Products
-
OriGene ORF clones in human for AXIN1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- VectorBuilder custom plasmid, inducible vectors for AXIN1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for AXIN1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for AXIN1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AXIN1
- Applied Biological Materials Clones for AXIN1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for AXIN1
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for AXIN1 Gene
Localization for AXIN1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for AXIN1 Gene
- Cytoplasm. Nucleus. Membrane. Cell membrane. Note=MACF1 is required for its translocation to cell membrane (By similarity). On UV irradiation, translocates to the nucleus and colocalizes with DAAX (PubMed:17210684). {ECO:0000250 UniProtKB:O35625, ECO:0000269 PubMed:17210684}.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| nucleus | 5 |
| cytosol | 5 |
| cytoskeleton | 2 |
| extracellular | 1 |
| lysosome | 1 |
| endosome | 1 |
- Nucleoli (3)
- Vesicles (3)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005634 | nucleus | IEA,IDA | 12072559 |
| GO:0005737 | cytoplasm | IDA,IEA | 12072559 |
| GO:0005829 | cytosol | TAS | -- |
| GO:0005886 | plasma membrane | IEA | -- |
| GO:0016020 | membrane | IEA | -- |
Pathways & Interactions for AXIN1 Gene
Pathways by source for AXIN1 Gene
1 GeneTex pathway for AXIN1 Gene
16 BioSystems pathways for AXIN1 Gene
26 Reactome pathways for AXIN1 Gene
12 KEGG pathways for AXIN1 Gene
1 GeneGo (Thomson Reuters) pathway for AXIN1 Gene
3 R&D Systems pathways for AXIN1 Gene
15 Qiagen pathways for AXIN1 Gene
1 Cell Signaling Technology pathway for AXIN1 Gene
Interacting Proteins for AXIN1 Gene
Selected Interacting proteins:
O15169-AXIN1_HUMAN
ENSP00000262320
for AXIN1 Gene via
IID
MINT
UniProtKB
STRING
GPS-Prot Interaction Network for AXIN1
SIGNOR curated interactions for AXIN1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001743 | optic placode formation | IBA | -- |
| GO:0001934 | positive regulation of protein phosphorylation | IDA | 9601641 |
| GO:0006915 | apoptotic process | IEA | -- |
| GO:0007165 | signal transduction | IEA | -- |
| GO:0007257 | activation of JUN kinase activity | IBA | -- |
Drugs & Compounds for AXIN1 Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| 1,4-Dithiothreitol | Experimental | Pharma | Target | 0 |
Transcripts for AXIN1 Gene
mRNA/cDNA for AXIN1 Gene
- (139) Selected AceView cDNA sequences:
- (4) Additional mRNA sequences :
- (12) REFSEQ mRNAs :
- (5) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000262320 3643 bps (uc002cgp.3)
- ENST00000354866 3324 bps (uc002cgq.3)
- ENST00000457798 334 bps (uc059ojd.1)
- ENST00000461023 6340 bps (uc059ojc.1)
- ENST00000481769 1089 bps (uc059oje.1)
CRISPR Products
-
OriGene CRISPR knockouts for AXIN1
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AXIN1
- genomics-online: gRNA clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
- Applied Biological Materials CRISPR for AXIN1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for AXIN1
- GenScript: Design CRISPR guide RNA sequences for AXIN1
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for AXIN1
- Browse OriGene Inhibitory RNA Products For AXIN1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AXIN1
- genomics-online: shRNA clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
Clone Products
-
OriGene ORF clones in human for AXIN1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- VectorBuilder custom plasmid, inducible vectors for AXIN1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for AXIN1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for AXIN1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AXIN1
- Applied Biological Materials Clones for AXIN1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
| ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5a | · | 5b | ^ | 6a | · | 6b | ^ | 7a | · | 7b | ^ | 8 | ^ | 9a | · | 9b | ^ | 10 | ^ | 11a | · | 11b |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | |||||||||||||||||||||||||||||
| SP2: | |||||||||||||||||||||||||||||||
| SP3: | |||||||||||||||||||||||||||||||
| SP4: | - | - | - | - | |||||||||||||||||||||||||||
| SP5: | |||||||||||||||||||||||||||||||
| SP6: |
Expression for AXIN1 Gene
This gene is overexpressed in Urinary Bladder (40.7), Platelet (9.6), and Heart (8.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AXIN1 Gene
NURSA nuclear receptor signaling pathways regulating expression of AXIN1 Gene:
AXIN1SOURCE GeneReport for Unigene cluster for AXIN1 Gene:
Hs.592082mRNA Expression by UniProt/SwissProt for AXIN1 Gene:
O15169-AXIN1_HUMAN
Tissue specificity:
Ubiquitously expressed.
Evidence on tissue expression from TISSUES for AXIN1 Gene
- Liver(4.3)
- Intestine(3)
- Nervous system(2.2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for AXIN1 Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- cardiovascular
- digestive
- immune
- integumentary
- nervous
- reproductive
- skeletal muscle
- skeleton
- urinary
Regions:
Head and neck:
- brain
- head
- meninges
- mouth
- neck
- salivary gland
Thorax:
- breast
- esophagus
Abdomen:
- intestine
- kidney
- large intestine
- liver
- small intestine
- spleen
Pelvis:
- pelvis
- penis
- testicle
- ureter
- urinary bladder
- uterus
Limb:
- digit
- finger
- foot
- hand
- lower limb
- nail
- toe
- upper limb
General:
- blood vessel
- coagulation system
- skin
- spinal column
- spinal cord
- vertebrae
Primer Products
-
OriGene qPCR primer pairs and template standards for AXIN1
-
OriGene qPCR primer pairs for AXIN1
- genomics-online: primer clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for AXIN1 Gene
Orthologs for AXIN1 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | AXIN1 34 33 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | AXIN1 34 33 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | AXIN1 34 33 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Axin1 33 |
|
||
| mouse (Mus musculus) |
Mammalia | Axin1 16 34 33 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | AXIN1 34 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | AXIN1 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | AXIN1 34 34 33 |
|
OneToMany | |
| -- 34 |
|
OneToMany | |||
| lizard (Anolis carolinensis) |
Reptilia | AXIN1 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | axin1 33 |
|
||
| African clawed frog (Xenopus laevis) |
Amphibia | LOC398097 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | axin1 34 33 33 |
|
OneToOne | |
| fruit fly (Drosophila melanogaster) |
Insecta | Axn 34 |
|
OneToMany | |
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToMany |
- Species where no ortholog for AXIN1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Evolution for AXIN1 Gene
- ENSEMBL:
- Gene Tree for AXIN1 (if available)
- TreeFam:
- Gene Tree for AXIN1 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for AXIN1: view image
Paralogs for AXIN1 Gene
Variants for AXIN1 Gene
| SNP ID | Clin | Chr 16 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs116350678 | Hepatocellular carcinoma (HCC) [MIM:114550] | 298,233(-) | C/T | coding_sequence_variant, downstream_transcript_variant, genic_downstream_transcript_variant, missense_variant, non_coding_transcript_variant | |
| rs117208012 | Hepatocellular carcinoma (HCC) [MIM:114550] | 297,063(-) | C/A/T | coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, non_coding_transcript_variant | |
| rs587776627 | pathogenic, Hepatocellular carcinoma | 309,973(-) | GGGAATGTGAGGTAGGGGCACCCGCCCATTGA/ | coding_sequence_variant, frameshift, intron_variant, non_coding_transcript_variant | |
| rs779951904 | Hepatocellular carcinoma (HCC) [MIM:114550] | 310,055(-) | G/A | 5_prime_UTR_variant, coding_sequence_variant, intron_variant, missense_variant, non_coding_transcript_variant | |
| VAR_015589 | Hepatocellular carcinoma (HCC) [MIM:114550] | p.Leu106Arg |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| dgv1281n106 | CNV | deletion | 24896259 |
| dgv32n68 | CNV | loss | 17160897 |
| dgv4808n54 | CNV | loss | 21841781 |
| dgv4809n54 | CNV | loss | 21841781 |
| dgv769e212 | CNV | loss | 25503493 |
| dgv770e212 | CNV | loss | 25503493 |
| dgv771e212 | CNV | loss | 25503493 |
| esv2422427 | CNV | duplication | 17116639 |
| esv27385 | CNV | gain | 19812545 |
| esv3581894 | CNV | loss | 25503493 |
| esv3637563 | CNV | gain | 21293372 |
| esv3637564 | CNV | gain | 21293372 |
| esv3637565 | CNV | loss | 21293372 |
| esv3637566 | CNV | gain | 21293372 |
| esv3637567 | CNV | loss | 21293372 |
| esv3637568 | CNV | gain | 21293372 |
| esv3637569 | CNV | loss | 21293372 |
| esv3637570 | CNV | gain | 21293372 |
| nsv1071243 | CNV | deletion | 25765185 |
| nsv1123000 | CNV | deletion | 24896259 |
| nsv1125366 | OTHER | inversion | 24896259 |
| nsv1134488 | CNV | deletion | 24896259 |
| nsv1147691 | OTHER | inversion | 26484159 |
| nsv515838 | CNV | loss | 19592680 |
| nsv570947 | CNV | loss | 21841781 |
| nsv570951 | CNV | loss | 21841781 |
| nsv570954 | CNV | loss | 21841781 |
| nsv827477 | CNV | gain | 20364138 |
| nsv9319 | CNV | gain | 18304495 |
| nsv952896 | CNV | deletion | 24416366 |
| nsv952897 | CNV | deletion | 24416366 |
Residual Variation Intolerance Score:
49.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
3.47;
55.06% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for AXIN1 Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AXIN1 Gene
Disorders for AXIN1 Gene
(10) MalaCards diseases for AXIN1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| caudal duplication anomaly |
|
|
| hepatocellular carcinoma |
|
|
| adult hepatocellular carcinoma |
|
|
| familial adenomatous polyposis |
|
|
| colorectal cancer 5 |
|
|
Search AXIN1 in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
AXIN1_HUMAN- Hepatocellular carcinoma (HCC) [MIM:114550]: A primary malignant neoplasm of epithelial liver cells. The major risk factors for HCC are chronic hepatitis B virus (HBV) infection, chronic hepatitis C virus (HCV) infection, prolonged dietary aflatoxin exposure, alcoholic cirrhosis, and cirrhosis due to other causes. {ECO:0000269 PubMed:12101426}. Note=The gene represented in this entry is involved in disease pathogenesis.
- Caudal duplication anomaly (CADUA) [MIM:607864]: A condition characterized by the occurrence of duplications of different organs in the caudal region. {ECO:0000269 PubMed:16773576}. Note=The disease is caused by mutations affecting the gene represented in this entry. Caudal duplication anomaly is associated with hypermethylation of the AXIN1 promoter.
Additional Disease Information for AXIN1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for AXIN1 Gene
Publications for AXIN1 Gene
- Association of genetic variation in genes implicated in the beta-catenin destruction complex with risk of breast cancer. (PMID: 18708403) Wang X … Couch FJ (Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 2008) 3 22 44 58
- Increased DNA methylation at the AXIN1 gene in a monozygotic twin from a pair discordant for a caudal duplication anomaly. (PMID: 16773576) Oates NA … Chong S (American journal of human genetics 2006) 3 4 22 58
- Multiple rare variants in different genes account for multifactorial inherited susceptibility to colorectal adenomas. (PMID: 15520370) Fearnhead NS … Bodmer WF (Proceedings of the National Academy of Sciences of the United States of America 2004) 3 22 44 58
- AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. (PMID: 10700176) Satoh S … Nakamura Y (Nature genetics 2000) 3 4 22 58
- The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. (PMID: 9230313) Zeng L … Costantini F (Cell 1997) 2 3 4 58
Products for AXIN1 Gene
- R&D Systems Antibodies for AXIN1 (Axin-1)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for AXIN1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for AXIN1
- Search Origene for MassSpec and Protein Over-expression Lysates for AXIN1
- Origene Custom Protein Services for AXIN1
- Origene sirna, shrna, and RNAi products in human, mouse, rat for AXIN1
- Browse OriGene Inhibitory RNA Products For AXIN1
- OriGene qPCR primer pairs and template standards for AXIN1
- OriGene qPCR primer pairs for AXIN1
- OriGene CRISPR knockouts for AXIN1
- OriGene ORF clones in human for AXIN1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For AXIN1
- GenScript: Next-day shipping of latest version cDNA ORF clones for AXIN1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for AXIN1
- GenScript Custom Assay Services for AXIN1
- GenScript Custom overexpressing Cell Line Services for AXIN1
- GenScript: Design CRISPR guide RNA sequences for AXIN1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for AXIN1
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for AXIN1
- Novus Biologicals lysates and proteins for AXIN1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- VectorBuilder custom plasmid, inducible vectors for AXIN1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for AXIN1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for AXIN1
- antibodies-online: Search results for 148 available AXIN1 Antibodies ranked by validation data
- Compare Top AXIN1 Antibodies
- antibodies-online: Search results for 8 available AXIN1 Elisa Kits ranked by validation data
- Compare Top AXIN1 Elisa Kits
- antibodies-online: Search results for 8 available AXIN1 Proteins ranked by validation data
- Compare Top AXIN1 Proteins
- GeneTex AXIN1 Antibody for AXIN1
- Search GeneTex for Proteins for AXIN1
- Santa Cruz Biotechnology (SCBT) Antibodies for AXIN1
- Search Santa Cruz Biotechnology (SCBT) for AXIN1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for AXIN1
- Custom Antibody ServicesProSci Antibodies for AXIN1
- Search for AXIN1 Proteins at ProSci
- Horizon Cell Lines for AXIN1
- genomics-online: cdna clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
- orf clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
- genomics-online: gRNA clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
- genomics-online: primer clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
- genomics-online: shRNA clones - Search results for 97 available AXIN1 gene related products
- Overview of 97 available AXIN1 gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for AXIN1
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for AXIN1
- GeneCopoeia miRNA 3'UTR Target clone products for AXIN1
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AXIN1
Sources for AXIN1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83)