Free for academic non-profit institutions. Other users need a Commercial license

AXIN1 Gene(Protein Coding)

Axin 1

GCID:
GC16M000338
GIFtS:
54
Genes Participants
UDN Logo

Aliases for AXIN1 Gene

Aliases for AXIN1 Gene

  • Axin 1 2 3 5
  • Protein Phosphatase 1, Regulatory Subunit 49 2 3
  • Axis Inhibition Protein 1 3 4
  • AXIN 3 4
  • Fused, Mouse, Homolog Of 3
  • Axis Inhibitor 1 3
  • PPP1R49 3
  • Axin-1 3
  • HAxin 4

External Ids for AXIN1 Gene

Previous GeneCards Identifiers for AXIN1 Gene

  • GC16M000356
  • GC16M000277

Summaries for AXIN1 Gene

Entrez Gene Summary for AXIN1 Gene

  • This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

GeneCards Summary for AXIN1 Gene

AXIN1 (Axin 1) is a Protein Coding gene. Diseases associated with AXIN1 include Caudal Duplication Anomaly and Hepatocellular Carcinoma. Among its related pathways are phosphorylation site mutants of CTNNB1 are not targeted to the proteasome by the destruction complex and Reelin Pathway (Cajal-Retzius cells). Gene Ontology (GO) annotations related to this gene include protein homodimerization activity and protein kinase binding. An important paralog of this gene is AXIN2.

UniProtKB/Swiss-Prot for AXIN1 Gene

  • Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling (PubMed:12192039, PubMed:27098453). Controls dorsoventral patterning via two opposing effects; down-regulates CTNNB1 to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway (PubMed:12192039). In Wnt signaling, probably facilitates the phosphorylation of CTNNB1 and APC by GSK3B (PubMed:12192039). Likely to function as a tumor suppressor. Enhances TGF-beta signaling by recruiting the RNF111 E3 ubiquitin ligase and promoting the degradation of inhibitory SMAD7 (PubMed:16601693). Also component of the AXIN1-HIPK2-TP53 complex which controls cell growth, apoptosis and development (PubMed:17210684). Facilitates the phosphorylation of TP53 by HIPK2 upon ultraviolet irradiation (PubMed:17210684).

Gene Wiki entry for AXIN1 Gene

Additional gene information for AXIN1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AXIN1 Gene

Genomics for AXIN1 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for AXIN1 Gene

Promoters and enhancers for AXIN1 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH16J000351 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 658.4 +7.6 7592 5.8 ARID4B SIN3A DMAP1 ZBTB7B YY1 TCF12 GLIS2 ZNF143 KLF13 SP3 AXIN1 TMEM8A UBE2I CHTF18 ENSG00000268836 WASH4P WDR24 LUC7L ENSG00000269482 WDR90
GH16J000358 Enhancer 1.4 Ensembl ENCODE dbSUPER 650.7 -0.6 -550 6.2 PKNOX1 FOXA2 MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2 ZNF48 ZNF143 AXIN1 TMEM8A MRPL28 ARHGDIG
GH16J000586 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 30.1 -229.6 -229635 8.4 HDGF PKNOX1 CLOCK SMAD1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 RAB40C GC16M000587 WDR90 ENSG00000261505 ENSG00000260051 WASH4P RHOT2 WFIKKN1 JMJD8 WDR24
GH16J001308 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 32.4 -949.3 -949257 5.2 CLOCK FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF416 ZNF143 UBE2I LOC102723815 WDR90 CRAMP1 ENSG00000261505 TELO2 ENSG00000260051 E4F1 TSC2 IFT140
GH16J000396 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 25.6 -38.4 -38386 7.7 HDGF ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B ZNF766 NME4 DECR2 WDR90 ENSG00000261505 WASH4P RHOT2 UBE2I WDR24 JMJD8 LUC7L
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around AXIN1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AXIN1 gene promoter:
  • c-Jun
  • ATF-2
  • AP-1
  • COUP-TF
  • COUP
  • HNF-4alpha1

Genomic Locations for AXIN1 Gene

Genomic Locations for AXIN1 Gene
chr16:287,440-361,497
(GRCh38/hg38)
Size:
74,058 bases
Orientation:
Minus strand
chr16:337,440-402,676
(GRCh37/hg19)
Size:
65,237 bases
Orientation:
Minus strand

Genomic View for AXIN1 Gene

Genes around AXIN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AXIN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AXIN1 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for AXIN1 Gene

Proteins for AXIN1 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for AXIN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O15169-AXIN1_HUMAN
    Recommended name:
    Axin-1
    Protein Accession:
    O15169
    Secondary Accessions:
    • Q4TT26
    • Q4TT27
    • Q86YA7
    • Q8WVW6
    • Q96S28

    Protein attributes for AXIN1 Gene

    Size:
    862 amino acids
    Molecular mass:
    95635 Da
    Quaternary structure:
    • Homodimer. Interacts with ZBED3; the interaction is direct, enhanced by protein kinase GSK3B and casein kinase CSNK1E activities and decreases GSK3B-induced beta-catenin serine and threonine phosphorylations (By similarity). Component of the beta-catenin destruction complex, containing at least, CTNNB1, an axin and GSK3B, that regulates CTNNB1 protein levels through phosphorylation and ubiquitination. Interacts with CTNNB1 (via the armadillo repeats 2-7). Interacts with GSK3B; the interaction hyperphosphorylates CTNNB1 leading to its ubiquitination and destruction (PubMed:17318175, PubMed:12554650). Component of the AXIN1-HIPK2-TP53 complex (PubMed:17210684). Interacts directly in the complex with TP53 and HIPK2 (PubMed:17210684). Interacts with DAXX; the interaction stimulates the interaction of DAXX with TP53, stimulates Ser-46 phosphorylation of TP53 and induces cell death on UV irradiation (PubMed:17210684). Also binds APC, SMAD6, SMAD7 and RNF111 (PubMed:16601693, PubMed:10811618). Interacts with DIXDC1; prevents interaction with MAP3K1 (PubMed:15262978). Interacts with MAP3K4 (PubMed:15262978). Interacts with ANKRD6 and AIDA (By similarity). Interacts with MDFI; the interaction decreases AXIN1-mediated JUN N-terminal kinase (JNK) activation (PubMed:12192039). Interacts with MDFIC; the interaction inhibits beta-cateninin-mediated signaling and AXIN1-mediated JUN N-terminal kinase (JNK) activation (PubMed:12192039). Interacts with LRP5 (via its phosphorylated PPPSP motifs); the interaction is stimulated by WNT1 and GSK3B and activates beta-catenin signaling (PubMed:11336703). Interacts (via the C-terminal) with PPP1CA; the interaction dephosphorylates AXIN1 and regulates interaction with GSK3B (PubMed:9920888). Interacts with PPP2CA; the interaction dephosphorylates AXIN1 (PubMed:9920888). Interacts with MACF1 (By similarity). Found in a complex composed of MACF1, APC, AXIN1, CTNNB1 and GSK3B (By similarity). Interacts with TNKS (PubMed:19759537, PubMed:21478859, PubMed:21799911). Interacts with DAB2; the interaction is mutually exclusive with the AXIN1:PPP1CA interaction (PubMed:12805222). Interacts with WDR26 (PubMed:27098453).
    SequenceCaution:
    • Sequence=AAC51624.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for AXIN1 Gene

    Alternative splice isoforms for AXIN1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AXIN1 Gene

Protein Expression for AXIN1 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for AXIN1 Gene

  • Phosphorylation and dephosphorylation of AXIN1 regulates assembly and function of the beta-catenin complex. Phosphorylated by CK1 and GSK3B. Dephosphorylated by PPP1CA and PPP2CA. Phosphorylation by CK1 enhances binding of GSK3B to AXIN1.
  • ADP-ribosylated by tankyrase TNKS and TNKS2. Poly-ADP-ribosylated protein is recognized by RNF146, followed by ubiquitination at Lys-48 and subsequent activation of the Wnt signaling pathway.
  • Ubiquitinated by RNF146 when poly-ADP-ribosylated, leading to its degradation and subsequent activation of the Wnt signaling pathway. Sumoylation at Lys-857 and Lys-860 prevents ubiquitination and degradation. Sumoylation is required for AXIN1-mediated JNK activation. Deubiquitinated by USP34, deubiquitinated downstream of beta-catenin stabilization step: deubiquitination is important for nuclear accumulation during Wnt signaling to positively regulate beta-catenin (CTNBB1)-mediated transcription.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for AXIN1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for AXIN1 Gene

Domains & Families for AXIN1 Gene

Gene Families for AXIN1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for AXIN1 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for AXIN1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

O15169

UniProtKB/Swiss-Prot:

AXIN1_HUMAN :
  • The tankyrase-binding motif (also named TBD) is required for interaction with tankyrase TNKS and TNKS2.
Domain:
  • The tankyrase-binding motif (also named TBD) is required for interaction with tankyrase TNKS and TNKS2.
genes like me logo Genes that share domains with AXIN1: view

Function for AXIN1 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for AXIN1 Gene

UniProtKB/Swiss-Prot Function:
Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling (PubMed:12192039, PubMed:27098453). Controls dorsoventral patterning via two opposing effects; down-regulates CTNNB1 to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway (PubMed:12192039). In Wnt signaling, probably facilitates the phosphorylation of CTNNB1 and APC by GSK3B (PubMed:12192039). Likely to function as a tumor suppressor. Enhances TGF-beta signaling by recruiting the RNF111 E3 ubiquitin ligase and promoting the degradation of inhibitory SMAD7 (PubMed:16601693). Also component of the AXIN1-HIPK2-TP53 complex which controls cell growth, apoptosis and development (PubMed:17210684). Facilitates the phosphorylation of TP53 by HIPK2 upon ultraviolet irradiation (PubMed:17210684).
GENATLAS Biochemistry:
axin 1,ubiquitously expressed (in mouse),negative regulator of the Wnt signaling pathway,promoting the GSK3B dependent phosphorylation of beta catenin CTNNB1

Phenotypes From GWAS Catalog for AXIN1 Gene

Gene Ontology (GO) - Molecular Function for AXIN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004871 obsolete signal transducer activity IDA --
GO:0005096 GTPase activator activity IBA --
GO:0005515 protein binding IPI 9601641
GO:0008013 beta-catenin binding IDA 10644691
GO:0019899 enzyme binding IPI 19759537
genes like me logo Genes that share ontologies with AXIN1: view
genes like me logo Genes that share phenotypes with AXIN1: view

Human Phenotype Ontology for AXIN1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for AXIN1 Gene

MGI Knock Outs for AXIN1:
  • Axin1 Axin1<tm1.2Dic>
  • Axin1 Axin1<tm1(Axin2)Cos>

Animal Model Products

Clone Products

  • Addgene plasmids for AXIN1

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for AXIN1 Gene

Localization for AXIN1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for AXIN1 Gene

Cytoplasm. Nucleus. Membrane. Cell membrane. Note=MACF1 is required for its translocation to cell membrane (By similarity). On UV irradiation, translocates to the nucleus and colocalizes with DAAX (PubMed:17210684). {ECO:0000250 UniProtKB:O35625, ECO:0000269 PubMed:17210684}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AXIN1 gene
Compartment Confidence
plasma membrane 5
nucleus 5
cytosol 5
cytoskeleton 2
extracellular 1
lysosome 1
endosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli (3)
  • Vesicles (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for AXIN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 12072559
GO:0005737 cytoplasm IDA,IEA 12072559
GO:0005829 cytosol TAS --
GO:0005886 plasma membrane IEA --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with AXIN1: view

Pathways & Interactions for AXIN1 Gene

SuperPathways for AXIN1 Gene

PathCards logo More details on SuperPathways for AXIN1
SuperPathway Contained pathways
1 phosphorylation site mutants of CTNNB1 are not targeted to the proteasome by the destruction complex
AMER1 mutants destabilize the destruction complex
.93
phosphorylation site mutants of CTNNB1 are not targeted to the proteasome by the destruction complex
.93
Disassembly of the destruction complex and recruitment of AXIN to the membrane
.47
Signaling by WNT in cancer
.43
Canonical Wnt signaling pathway
.31
APC truncation mutants have impaired AXIN binding
.01
AXIN missense mutants destabilize the destruction complex
.01
AXIN mutants destabilize the destruction complex, activating WNT signaling
.01
Beta-catenin phosphorylation cascade
.01
Misspliced GSK3beta mutants stabilize beta-catenin
.01
S33 mutants of beta-catenin arent phosphorylated
.01
S37 mutants of beta-catenin arent phosphorylated
.01
S45 mutants of beta-catenin arent phosphorylated
.01
T41 mutants of beta-catenin arent phosphorylated
.01
truncated APC mutants destabilize the destruction complex
.01
Truncations of AMER1 destabilize the destruction complex
.01
2 Gastric cancer
Breast cancer
.62
Gastric cancer
.62
Hepatocellular carcinoma
.50
3 Wnt Signaling Pathway and Pluripotency
Wnt Signaling Pathway
.58
Wnt Signaling Pathway and Pluripotency
.58
Wnt signaling pathway
.35
4 EphB-EphrinB Signaling
EphB-EphrinB Signaling
.58
Ephrin-Eph Signaling
.58
Cytoskeleton remodeling Reverse signaling by ephrin B
.33
5 Wnt Signaling Pathways: beta-Catenin-dependent Wnt Signaling
Basal cell carcinoma
.35
Wnt Signaling Pathways: beta-Catenin-dependent Wnt Signaling
.35
genes like me logo Genes that share pathways with AXIN1: view

SIGNOR curated interactions for AXIN1 Gene

Activates:
Inactivates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for AXIN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001743 optic placode formation IBA --
GO:0001934 positive regulation of protein phosphorylation IDA 9601641
GO:0006915 apoptotic process IEA --
GO:0007165 signal transduction IEA --
GO:0007257 activation of JUN kinase activity IBA --
genes like me logo Genes that share ontologies with AXIN1: view

Drugs & Compounds for AXIN1 Gene

Products:

  1. Drug

(1) Drugs for AXIN1 Gene - From: DrugBank

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
1,4-Dithiothreitol Experimental Pharma Target 0
genes like me logo Genes that share compounds with AXIN1: view

Transcripts for AXIN1 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for AXIN1 Gene

(12) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(139) Selected AceView cDNA sequences:
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for AXIN1 Gene

Axin 1:
Representative Sequences:

Clone Products

  • Addgene plasmids for AXIN1

Alternative Splicing Database (ASD) splice patterns (SP) for AXIN1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10 ^ 11a · 11b
SP1: - -
SP2:
SP3:
SP4: - - - -
SP5:
SP6:

Relevant External Links for AXIN1 Gene

GeneLoc Exon Structure for
AXIN1
ECgene alternative splicing isoforms for
AXIN1

Expression for AXIN1 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AXIN1 Gene

mRNA expression in normal human tissues for AXIN1 Gene
mRNA expression by GTEx for AXIN1 GenemRNA expression by BioGPS for AXIN1 Gene

Protein differential expression in normal tissues from HIPED for AXIN1 Gene

This gene is overexpressed in Urinary Bladder (40.7), Platelet (9.6), and Heart (8.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AXIN1 Gene



Protein tissue co-expression partners for AXIN1 Gene

NURSA nuclear receptor signaling pathways regulating expression of AXIN1 Gene:

AXIN1

SOURCE GeneReport for Unigene cluster for AXIN1 Gene:

Hs.592082

mRNA Expression by UniProt/SwissProt for AXIN1 Gene:

O15169-AXIN1_HUMAN
Tissue specificity: Ubiquitously expressed.

Evidence on tissue expression from TISSUES for AXIN1 Gene

  • Liver(4.3)
  • Intestine(3)
  • Nervous system(2.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for AXIN1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • head
  • meninges
  • mouth
  • neck
  • salivary gland
Thorax:
  • breast
  • esophagus
Abdomen:
  • intestine
  • kidney
  • large intestine
  • liver
  • small intestine
  • spleen
Pelvis:
  • pelvis
  • penis
  • testicle
  • ureter
  • urinary bladder
  • uterus
Limb:
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • nail
  • toe
  • upper limb
General:
  • blood vessel
  • coagulation system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with AXIN1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for AXIN1 Gene

Orthologs for AXIN1 Gene

This gene was present in the common ancestor of animals.

Orthologs for AXIN1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia AXIN1 34 33
  • 98.98 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia AXIN1 34 33
  • 85.61 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia AXIN1 34 33
  • 84.77 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Axin1 33
  • 84.06 (n)
mouse
(Mus musculus)
 Mammalia Axin1 16 34 33
  • 83.64 (n)
oppossum
(Monodelphis domestica)
 Mammalia AXIN1 34
  • 79 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia AXIN1 34
  • 52 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves AXIN1 34 34 33
  • 73.16 (n)
 OneToMany
-- 34
  • 73 (a)
 OneToMany
lizard
(Anolis carolinensis)
 Reptilia AXIN1 34
  • 60 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia axin1 33
  • 69.72 (n)
African clawed frog
(Xenopus laevis)
 Amphibia LOC398097 33
zebrafish
(Danio rerio)
 Actinopterygii axin1 34 33 33
  • 68.13 (n)
 OneToOne
fruit fly
(Drosophila melanogaster)
 Insecta Axn 34
  • 24 (a)
 OneToMany
sea squirt
(Ciona savignyi)
 Ascidiacea -- 34
  • 22 (a)
 OneToMany
Species where no ortholog for AXIN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for AXIN1 Gene

ENSEMBL:
Gene Tree for AXIN1 (if available)
TreeFam:
Gene Tree for AXIN1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for AXIN1: view image

Paralogs for AXIN1 Gene

Paralogs for AXIN1 Gene

(4) SIMAP similar genes for AXIN1 Gene using alignment to 3 proteins:

  • AXIN1_HUMAN
  • B1AH42_HUMAN
  • H0Y830_HUMAN
genes like me logo Genes that share paralogs with AXIN1: view

Variants for AXIN1 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for AXIN1 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs116350678 Hepatocellular carcinoma (HCC) [MIM:114550] 298,233(-) C/T coding_sequence_variant, downstream_transcript_variant, genic_downstream_transcript_variant, missense_variant, non_coding_transcript_variant
rs117208012 Hepatocellular carcinoma (HCC) [MIM:114550] 297,063(-) C/A/T coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, non_coding_transcript_variant
rs587776627 pathogenic, Hepatocellular carcinoma 309,973(-) GGGAATGTGAGGTAGGGGCACCCGCCCATTGA/ coding_sequence_variant, frameshift, intron_variant, non_coding_transcript_variant
rs779951904 Hepatocellular carcinoma (HCC) [MIM:114550] 310,055(-) G/A 5_prime_UTR_variant, coding_sequence_variant, intron_variant, missense_variant, non_coding_transcript_variant
VAR_015589 Hepatocellular carcinoma (HCC) [MIM:114550] p.Leu106Arg

Structural Variations from Database of Genomic Variants (DGV) for AXIN1 Gene

Variant ID Type Subtype PubMed ID
dgv1281n106 CNV deletion 24896259
dgv32n68 CNV loss 17160897
dgv4808n54 CNV loss 21841781
dgv4809n54 CNV loss 21841781
dgv769e212 CNV loss 25503493
dgv770e212 CNV loss 25503493
dgv771e212 CNV loss 25503493
esv2422427 CNV duplication 17116639
esv27385 CNV gain 19812545
esv3581894 CNV loss 25503493
esv3637563 CNV gain 21293372
esv3637564 CNV gain 21293372
esv3637565 CNV loss 21293372
esv3637566 CNV gain 21293372
esv3637567 CNV loss 21293372
esv3637568 CNV gain 21293372
esv3637569 CNV loss 21293372
esv3637570 CNV gain 21293372
nsv1071243 CNV deletion 25765185
nsv1123000 CNV deletion 24896259
nsv1125366 OTHER inversion 24896259
nsv1134488 CNV deletion 24896259
nsv1147691 OTHER inversion 26484159
nsv515838 CNV loss 19592680
nsv570947 CNV loss 21841781
nsv570951 CNV loss 21841781
nsv570954 CNV loss 21841781
nsv827477 CNV gain 20364138
nsv9319 CNV gain 18304495
nsv952896 CNV deletion 24416366
nsv952897 CNV deletion 24416366

Variation tolerance for AXIN1 Gene

Residual Variation Intolerance Score: 49.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.47; 55.06% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AXIN1 Gene

Human Gene Mutation Database (HGMD)
AXIN1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
AXIN1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AXIN1 Gene

Disorders for AXIN1 Gene

MalaCards: The human disease database

(10) MalaCards diseases for AXIN1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
caudal duplication anomaly
  • caudal duplication
hepatocellular carcinoma
  • hcc
adult hepatocellular carcinoma
  • adult primary hepatocellular carcinoma
familial adenomatous polyposis
  • adenomatous polyposis of the colon
colorectal cancer 5
  • colorectal cancer, susceptibility to, 5
- elite association - COSMIC cancer census association via MalaCards
Search AXIN1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

AXIN1_HUMAN
  • Hepatocellular carcinoma (HCC) [MIM:114550]: A primary malignant neoplasm of epithelial liver cells. The major risk factors for HCC are chronic hepatitis B virus (HBV) infection, chronic hepatitis C virus (HCV) infection, prolonged dietary aflatoxin exposure, alcoholic cirrhosis, and cirrhosis due to other causes. {ECO:0000269 PubMed:12101426}. Note=The gene represented in this entry is involved in disease pathogenesis.
  • Caudal duplication anomaly (CADUA) [MIM:607864]: A condition characterized by the occurrence of duplications of different organs in the caudal region. {ECO:0000269 PubMed:16773576}. Note=The disease is caused by mutations affecting the gene represented in this entry. Caudal duplication anomaly is associated with hypermethylation of the AXIN1 promoter.

Additional Disease Information for AXIN1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with AXIN1: view

No data available for Genatlas for AXIN1 Gene

Publications for AXIN1 Gene

  1. Association of genetic variation in genes implicated in the beta-catenin destruction complex with risk of breast cancer. (PMID: 18708403) Wang X … Couch FJ (Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 2008) 3 22 44 58
  2. Increased DNA methylation at the AXIN1 gene in a monozygotic twin from a pair discordant for a caudal duplication anomaly. (PMID: 16773576) Oates NA … Chong S (American journal of human genetics 2006) 3 4 22 58
  3. Multiple rare variants in different genes account for multifactorial inherited susceptibility to colorectal adenomas. (PMID: 15520370) Fearnhead NS … Bodmer WF (Proceedings of the National Academy of Sciences of the United States of America 2004) 3 22 44 58
  4. AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. (PMID: 10700176) Satoh S … Nakamura Y (Nature genetics 2000) 3 4 22 58
  5. The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. (PMID: 9230313) Zeng L … Costantini F (Cell 1997) 2 3 4 58

Products for AXIN1 Gene

  • Addgene plasmids for AXIN1

Sources for AXIN1 Gene