Aliases for ATXN8OS Gene
Subcategory (RNA class) for ATXN8OS Gene
antisense
Quality Score for this RNA gene is
13.2
Aliases for ATXN8OS Gene
External Ids for ATXN8OS Gene
- HGNC: 10561
- Entrez Gene: 6315
- Ensembl: ENSG00000230223
- OMIM: 603680
- UniProtKB: P0DMR3
Previous HGNC Symbols for ATXN8OS Gene
- SCA8
- KLHL1AS
Previous GeneCards Identifiers for ATXN8OS Gene
- GC13P069579
- GC13P070681
- GC13P051383
Summaries for ATXN8OS Gene
-
This gene is an antisense transcript to the KLHL1 gene (homolog to the Drosophila KELCH gene); it does not itself appear to be protein coding. A TAC/TGC trinucleotide repeat expansion that is incorporated into this gene transcript, but not the KLHL1 transcript, causes spinocerebellar ataxia type 8. Presumably the expansion interferes with normal antisense function of this transcript. [provided by RefSeq, Oct 2008]
GeneCards Summary for ATXN8OS Gene
ATXN8OS (ATXN8 Opposite Strand LncRNA) is an RNA Gene, and is affiliated with the antisense RNA class. Diseases associated with ATXN8OS include Spinocerebellar Ataxia 8 and Autosomal Dominant Cerebellar Ataxia.
fRNAdb sequence ontologies for ATXN8OS Gene
-
nc_conserved_region: Non-coding region of sequence similarity by descent from a common ancestor.
Additional gene information for ATXN8OS Gene
- HGNC(10561)
- Entrez Gene(6315)
- Ensembl(ENSG00000230223)
- OMIM(603680)
- UniProtKB(P0DMR3)
- RNACentral(ATXN8OS)
- Monarch Initiative
- Search for ATXN8OS at DataMed
- Search for ATXN8OS at HumanCyc
No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary and piRNA Summary for ATXN8OS Gene
Genomics for ATXN8OS Gene
GeneHancer (GH) Regulatory Elements for ATXN8OS Gene
Promoters and enhancers for ATXN8OS Gene
| GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
|---|---|---|---|---|---|---|---|---|---|---|
| GH13J070108 | Promoter | 0.5 | EPDnew | 650.7 | +1.3 | 1259 | 0.1 | ATXN8OS KLHL1 | ||
| GH13J070248 | Enhancer | 0.7 | ENCODE | 11.1 | +142.3 | 142285 | 1.2 | ELF3 SOX13 FOXA2 ZNF792 SAP130 ZNF644 RARA NR2F6 FOS SOX5 | ATXN8OS KLHL1 GC13P070460 | |
| GH13J070097 | Enhancer | 0.2 | FANTOM5 | 0.4 | -9.9 | -9932 | 0.3 | ATXN8OS LUC7L3P1 KLHL1 |
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)
GeneHancers around ATXN8OS on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the ATXN8OS gene promoter:
-
- TBP
- TFIID
- Nkx2-5
Regulatory Element Products
Genomic Locations for ATXN8OS Gene
Genomic Locations for ATXN8OS Gene
- chr13:70,107,213-70,139,753
- (GRCh38/hg38)
- Size:
- 32,541 bases
- Orientation:
- Plus strand
- chr13:70,681,345-70,713,885
- (GRCh37/hg19)
- Size:
- 32,541 bases
- Orientation:
- Plus strand
Genomic View for ATXN8OS Gene
Genes around ATXN8OS on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 13q21.33 by Entrez Gene
- 13q21.33 by HGNC
- 13q21.33 by Ensembl
ATXN8OS Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for ATXN8OS Gene
ORGUL Member Location for ATXN8OS Gene
Proteins for ATXN8OS Gene
-
Protein details for ATXN8OS Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P0DMR3-AT8OS_HUMAN
- Recommended name:
- Putative protein ATXN8OS
- Protein Accession:
- P0DMR3
Protein attributes for ATXN8OS Gene
- Size:
- 200 amino acids
- Molecular mass:
- 22759 Da
- Quaternary structure:
- No Data Available
Post-translational modifications for ATXN8OS Gene
No Post-translational modifications
Antibody Products
- Search GeneTex for Antibodies for ATXN8OS
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for ATXN8OS
- Origene Custom Protein Services for ATXN8OS
- Search GeneTex for Proteins for ATXN8OS
No data available for DME Specific Peptides for ATXN8OS Gene
Domains & Families for ATXN8OS Gene
Gene Families for ATXN8OS Gene
Protein Domains for ATXN8OS Gene
- ProtoNet:
Graphical View of Domain Structure for InterPro Entry
No data available for Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for ATXN8OS Gene
Function for ATXN8OS Gene
Phenotypes From GWAS Catalog for ATXN8OS Gene
Phenotypes for ATXN8OS Gene
- GenomeRNAi human phenotypes for ATXN8OS:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for ATXN8OS
-
CRISPR Products
- Browse CRISPR knockouts for ATXN8OS
- Applied Biological Materials CRISPR for ATXN8OS
-
Vectors and viruses for KO, Activation, Repression, and more
miRNA Products
Inhibitory RNA Products
Clone Products
- GenScript: Custom all cDNA clones Services for ATXN8OS
- VectorBuilder custom plasmid, inducible vectors for ATXN8OS
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ATXN8OS
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for ATXN8OS
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for ATXN8OS Gene
Localization for ATXN8OS Gene
Subcellular locations from UniProtKB/Swiss-Prot for ATXN8OS Gene
- Cytoplasm.
No data available for Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for ATXN8OS Gene
Transcripts for ATXN8OS Gene
fRNAdb Secondary structures for ATXN8OS Gene
mRNA/cDNA for ATXN8OS Gene
- (1) Additional mRNA sequences :
- (2) Ensembl transcripts including schematic representations, and UCSC links where relevant :
-
- ENST00000414504 1148 bps (uc010aej.2)
- ENST00000424524 1236 bps (uc058xke.1)
- (3) RNA Central transcripts :
Unigene Clusters for ATXN8OS Gene
CRISPR Products
- Browse CRISPR knockouts for ATXN8OS
- Applied Biological Materials CRISPR for ATXN8OS
-
Vectors and viruses for KO, Activation, Repression, and more
miRNA Products
Inhibitory RNA Products
Clone Products
- GenScript: Custom all cDNA clones Services for ATXN8OS
- VectorBuilder custom plasmid, inducible vectors for ATXN8OS
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ATXN8OS
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for ATXN8OS
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for ATXN8OS Gene
mRNA differential expression in normal tissues according to GTEx for ATXN8OS Gene
This gene is overexpressed in Brain - Substantia nigra (x19.5) and Brain - Hypothalamus (x10.0).
NURSA nuclear receptor signaling pathways regulating expression of ATXN8OS Gene:
ATXN8OSSOURCE GeneReport for Unigene cluster for ATXN8OS Gene:
Hs.676453mRNA Expression by UniProt/SwissProt for ATXN8OS Gene:
P0DMR3-AT8OS_HUMAN
Tissue specificity:
Expressed in brain (PubMed:10192387). Expressed in muscle tissues (at protein level).
Phenotype-based relationships between genes and organs from Gene ORGANizer for ATXN8OS Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- digestive
- nervous
- skeletal muscle
Regions:
Head and neck:
- brain
- cerebellum
- cranial nerve
- eye
- head
- mouth
- pharynx
Thorax:
- esophagus
Abdomen:
- stomach
General:
- peripheral nerve
- peripheral nervous system
- spinal cord
Primer Products
-
OriGene qPCR primer pairs for ATXN8OS
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and Evidence on tissue expression from TISSUES for ATXN8OS Gene
Orthologs for ATXN8OS Gene
No data available for Orthologs for ATXN8OS Gene
Paralogs for ATXN8OS Gene
No data available for Paralogs for ATXN8OS Gene
Variants for ATXN8OS Gene
| SNP ID | Clin | Chr 13 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs193922930 | pathogenic, risk-factor, Spinocerebellar ataxia 8, Parkinson disease, late-onset | 70,139,384(+) | CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC/CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_variant | |
| rs1000163239 | -- | 70,128,239(+) | A/G | intron_variant | |
| rs1000206654 | -- | 70,110,732(+) | A/C | intron_variant | |
| rs1000251497 | -- | 70,125,408(+) | C/T | intron_variant | |
| rs1000257546 | -- | 70,110,998(+) | A/T | intron_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv1051815 | CNV | gain | 25217958 |
| nsv1053979 | CNV | loss | 25217958 |
| nsv1122840 | CNV | deletion | 24896259 |
| nsv455967 | CNV | loss | 19166990 |
| nsv562220 | CNV | loss | 21841781 |
| nsv562221 | CNV | loss | 21841781 |
| nsv562222 | CNV | loss | 21841781 |
Additional Variant Information for ATXN8OS Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for ATXN8OS Gene
Disorders for ATXN8OS Gene
(6) MalaCards diseases for ATXN8OS Gene - From: HGMD, LncRNADisease, OMIM, GTR, Orphanet, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| spinocerebellar ataxia 8 |
|
|
| autosomal dominant cerebellar ataxia |
|
|
| spinocerebellar ataxia 12 |
|
|
| friedreich ataxia 1 |
|
|
| spinocerebellar ataxia 1 |
|
|
Search ATXN8OS in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for ATXN8OS
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for ATXN8OS Gene
Publications for ATXN8OS Gene
- Screening for premutation in the FMR1 gene in male patients suspected of spinocerebellar ataxia. (PMID: 19235102) Rajkiewicz M … Zaremba J (Neurologia i neurochirurgia polska 2008) 3 22 44 58
- Polymorphism of trinucleotide repeats in non-translated regions of SCA8 and SCA12 genes: allele distribution in a Polish control group. (PMID: 14960773) Sułek A … Zaremba J (Journal of applied genetics 2004) 3 22 44 58
- Analysis of SCA8 and SCA12 loci in 134 Italian ataxic patients negative for SCA1-3, 6 and 7 CAG expansions. (PMID: 12140678) Brusco A … Orsi L (Journal of neurology 2002) 3 22 44 58
- An untranslated CTG expansion causes a novel form of spinocerebellar ataxia (SCA8) (PMID: 10192387) Koob MD … Ranum LP (Nature genetics 1999) 2 3 4 58
- Internal ribosome entry segment activity of ATXN8 opposite strand RNA. (PMID: 24040107) Chen IC … Lee-Chen GJ (PloS one 2013) 3 4 58
Products for ATXN8OS Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for ATXN8OS
- Origene Custom Protein Services for ATXN8OS
- Browse OriGene Inhibitory RNA Products For ATXN8OS
- OriGene qPCR primer pairs for ATXN8OS
- Browse CRISPR knockouts for ATXN8OS
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For ATXN8OS
- GenScript: Custom all cDNA clones Services for ATXN8OS
- GenScript Custom Purified and Recombinant Proteins Services for ATXN8OS
- GenScript Custom Assay Services for ATXN8OS
- GenScript Custom overexpressing Cell Line Services for ATXN8OS
- Browse GenScript CRISPR for ATXN8OS
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for ATXN8OS
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Cyagen custom Knockout/knockin (KOKI) mouse models for ATXN8OS
- VectorBuilder custom plasmid, inducible vectors for ATXN8OS
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ATXN8OS
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for knockout CRISPR/Cas9 clones, lentivirus, and/or AAV products for ATXN8OS
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles, and/or promoter clone products for ATXN8OS
- Search GeneCopoeia for miRNA 3'UTR Target clone products for ATXN8OS
- Search GeneCopoeia for shRNA, lentivirus, and/or AAV clone products for ATXN8OS
Sources for ATXN8OS Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
- (159) GlyConnect
- (160) Aminode
- (161) GeneCopoeia
- (162) GPS-Prot
- (163) RNACentral
- (164) LncRNADisease
- (165) LOVD
- (166) miR2Disease
- (167) DiseaseEnhancer
- (168) Boster Bio
- (169) Biorbyt