Aliases for ATXN7 Gene
Aliases for ATXN7 Gene
External Ids for ATXN7 Gene
- HGNC: 10560
- Entrez Gene: 6314
- Ensembl: ENSG00000163635
- OMIM: 607640
- UniProtKB: O15265
Previous HGNC Symbols for ATXN7 Gene
- SCA7
Summaries for ATXN7 Gene
-
The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
GeneCards Summary for ATXN7 Gene
ATXN7 (Ataxin 7) is a Protein Coding gene. Diseases associated with ATXN7 include Spinocerebellar Ataxia 7 and Retinal Degeneration. Among its related pathways are Metabolism of proteins and Akt Signaling. Gene Ontology (GO) annotations related to this gene include chromatin binding. An important paralog of this gene is ATXN7L1.
UniProtKB/Swiss-Prot for ATXN7 Gene
-
Acts as component of the STAGA transcription coactivator-HAT complex. Mediates the interaction of STAGA complex with the CRX and is involved in CRX-dependent gene activation. Necessary for microtubule cytoskeleton stabilization.
Additional gene information for ATXN7 Gene
- Monarch Initiative
- Search for ATXN7 at DataMed
- Search for ATXN7 at HumanCyc
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ATXN7 Gene
Genomics for ATXN7 Gene
GeneHancer (GH) Regulatory Elements for ATXN7 Gene
Promoters and enhancers for ATXN7 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around ATXN7 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the ATXN7 gene promoter:
Regulatory Element Products
Genomic Locations for ATXN7 Gene
Genomic Locations for ATXN7 Gene
- chr3:63,864,557-64,003,462
- (GRCh38/hg38)
- Size:
- 138,906 bases
- Orientation:
- Plus strand
- chr3:63,850,233-63,989,138
- (GRCh37/hg19)
Genomic View for ATXN7 Gene
Genes around ATXN7 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 3p14.1 by Ensembl
- 3p14.1 by Entrez Gene
- 3p14.1 by HGNC
ATXN7 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for ATXN7 Gene
Proteins for ATXN7 Gene
-
Protein details for ATXN7 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- O15265-ATX7_HUMAN
- Recommended name:
- Ataxin-7
- Protein Accession:
- O15265
- B4E207
- E9PHP9
- O75328
- O75329
- Q9Y6P8
Protein attributes for ATXN7 Gene
- Size:
- 892 amino acids
- Molecular mass:
- 95451 Da
- Quaternary structure:
-
- Component of the STAGA transcription coactivator-HAT complex, at least composed of SUPT3H, GCN5L2, TAF5L, TAF6L, SUPT7L, TADA3L, TAD1L, TAF10, TAF12, TRRAP, TAF9 and ATXN7. The STAGA core complex is associated with a subcomplex required for histone deubiquitination composed of ATXN7L3, ENY2 and USP22. Interacts with SORBS1, PSMC1 and CRX. Interacts with TRRAP, GCN5L2 and TAF10. Interacts with alpha tubulin.
Protein Expression for ATXN7 Gene
Post-translational modifications for ATXN7 Gene
- Proteolytically cleaved. The cleavage may be involved in SCA7 degeneration: the isoform fragments may exert distinct toxic influences that could contribute to selective neurodegeneration.
- Sumoylation decreases the aggregation propensity and cellular toxicity of forms with an expanded poly-Gln region but has no effect on subcellular location or interaction with components of the STAGA complex.
- Modification sites at PhosphoSitePlus
- Modification sites at neXtProt
Other Protein References for ATXN7 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for ATXN7
- Novus Biologicals Antibodies for ATXN7
-
Abcam antibodies for ATXN7
- Invitrogen Antibodies for ATXN7
- GeneTex ATXN7 antibody for ATXN7
Protein Products
-
OriGene Purified Proteins for ATXN7
- Search Origene for MassSpec and Protein Over-expression Lysates for ATXN7
- Origene Custom Protein Services for ATXN7
- Search GeneTex for Proteins for ATXN7
-
Abcam proteins for ATXN7
Assay Products
No data available for DME Specific Peptides for ATXN7 Gene
Domains & Families for ATXN7 Gene
Gene Families for ATXN7 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for ATXN7 Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for ATXN7 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
O15265- Family:
-
- Belongs to the ataxin-7 family.
Function for ATXN7 Gene
Molecular function for ATXN7 Gene
- UniProtKB/Swiss-Prot Function:
- Acts as component of the STAGA transcription coactivator-HAT complex. Mediates the interaction of STAGA complex with the CRX and is involved in CRX-dependent gene activation. Necessary for microtubule cytoskeleton stabilization.
Phenotypes From GWAS Catalog for ATXN7 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003682 | chromatin binding | IEA | -- |
| GO:0005515 | protein binding | IPI | 11371513 |
| GO:0036459 | thiol-dependent ubiquitinyl hydrolase activity | TAS | -- |
Phenotypes for ATXN7 Gene
- MGI mutant phenotypes for ATXN7:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for ATXN7:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for ATXN7
-
-
ViGene Biosciences lentiviral particle packaged cDNA for ATXN7 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for ATXN7 gene
- Search ViGene Biosciences for ATXN7
CRISPR Products
-
OriGene CRISPR knockouts for ATXN7
- genomics-online: gRNA clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
- Applied Biological Materials CRISPR for ATXN7
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ATXN7
- GenScript: Design CRISPR guide RNA sequences for ATXN7
miRNA for ATXN7 Gene
- miRTarBase miRNAs that target ATXN7
-
- hsa-mir-192-5p (MIRT004157)
- hsa-mir-423-3p (MIRT016681)
- hsa-mir-342-3p (MIRT043675)
- hsa-mir-92a-3p (MIRT049634)
- hsa-mir-17-5p (MIRT050978)
- hsa-mir-3978 (MIRT447213)
- hsa-mir-4753-3p (MIRT447214)
- hsa-mir-452-3p (MIRT447215)
- hsa-mir-5093 (MIRT447216)
- hsa-mir-9-5p (MIRT447217)
- hsa-mir-130b-5p (MIRT447218)
- hsa-mir-4635 (MIRT450293)
- hsa-mir-6833-3p (MIRT641306)
- hsa-mir-4768-5p (MIRT641307)
- hsa-mir-6873-3p (MIRT641308)
- hsa-mir-519e-5p (MIRT641309)
- hsa-mir-515-5p (MIRT641310)
- hsa-mir-502-5p (MIRT641311)
- hsa-mir-211-5p (MIRT641312)
- hsa-mir-204-5p (MIRT641313)
- hsa-mir-3124-3p (MIRT641314)
- hsa-mir-6845-3p (MIRT641315)
- hsa-mir-4685-3p (MIRT641316)
- hsa-mir-4287 (MIRT641317)
- hsa-mir-5695 (MIRT641318)
- hsa-mir-519d-5p (MIRT641319)
- hsa-mir-6832-3p (MIRT641320)
- hsa-mir-4262 (MIRT641321)
- hsa-mir-181d-5p (MIRT641322)
- hsa-mir-181c-5p (MIRT641323)
- hsa-mir-181b-5p (MIRT641324)
- hsa-mir-181a-5p (MIRT641325)
- hsa-mir-19a-3p (MIRT728245)
- hsa-mir-19b-3p (MIRT728246)
miRNA Products
- Search ViGene Biosciences for ATXN7
Inhibitory RNA Products
- Origene RNAi, shrna, and sirna products in human, mouse, rat for ATXN7
- Browse OriGene Inhibitory RNA Products For ATXN7
- genomics-online: shRNA clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for ATXN7 gene
Clone Products
-
OriGene ORF clones in human for ATXN7
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- VectorBuilder custom plasmid, inducible vectors for ATXN7
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ATXN7
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for ATXN7
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for ATXN7
-
ViGene Biosciences adenoviral particle packaged cDNA for ATXN7 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for ATXN7 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for ATXN7 gene
No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for ATXN7 Gene
Localization for ATXN7 Gene
Subcellular locations from UniProtKB/Swiss-Prot for ATXN7 Gene
- Isoform a: Nucleus. Nucleus, nucleolus. Nucleus matrix. Cytoplasm, cytoskeleton. Note=In addition to a diffuse distribution throughout the nucleus, it is associated with the nuclear matrix and the nucleolus. It is able to shuttle between the nucleus and cytoplasm.
- Isoform b: Cytoplasm.
| Compartment | Confidence |
|---|---|
| cytoskeleton | 5 |
| nucleus | 5 |
| cytosol | 5 |
| extracellular | 1 |
| mitochondrion | 1 |
- Cytosol (3)
- Nucleoplasm (3)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005634 | nucleus | TAS,IDA | 22100762 |
| GO:0005654 | nucleoplasm | TAS | -- |
| GO:0005730 | nucleolus | IEA | -- |
| GO:0005737 | cytoplasm | IEA | -- |
| GO:0005829 | cytosol | IDA | -- |
Pathways & Interactions for ATXN7 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Chromatin organization | ||
| 2 | Deubiquitination |
.74
|
|
| 3 | Metabolism of proteins | ||
| 4 | Akt Signaling |
.60
|
|
| 5 | Chks in Checkpoint Regulation | ||
Pathways by source for ATXN7 Gene
7 Reactome pathways for ATXN7 Gene
2 Qiagen pathways for ATXN7 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000226 | microtubule cytoskeleton organization | IMP | 22100762 |
| GO:0006351 | transcription, DNA-templated | IEA | -- |
| GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
| GO:0006997 | nucleus organization | TAS | 10441328 |
| GO:0007601 | visual perception | TAS | 9288099 |
No data available for SIGNOR curated interactions for ATXN7 Gene
Transcripts for ATXN7 Gene
mRNA/cDNA for ATXN7 Gene
- (3) REFSEQ mRNAs :
- (5) Additional mRNA sequences :
- (145) Selected AceView cDNA sequences:
- (13) Ensembl transcripts including schematic representations, and UCSC links where relevant :
CRISPR Products
-
OriGene CRISPR knockouts for ATXN7
- genomics-online: gRNA clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
- Applied Biological Materials CRISPR for ATXN7
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ATXN7
- GenScript: Design CRISPR guide RNA sequences for ATXN7
miRNA Products
- Search ViGene Biosciences for ATXN7
Inhibitory RNA Products
- Origene RNAi, shrna, and sirna products in human, mouse, rat for ATXN7
- Browse OriGene Inhibitory RNA Products For ATXN7
- genomics-online: shRNA clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for ATXN7 gene
Clone Products
-
OriGene ORF clones in human for ATXN7
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- VectorBuilder custom plasmid, inducible vectors for ATXN7
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ATXN7
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for ATXN7
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
| ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6 | ^ | 7 | ^ | 8a | · | 8b | ^ | 9a | · | 9b | · | 9c | ^ | 10a | · | 10b | ^ | 11 | ^ | 12a | · | 12b | ^ | 13 | ^ | 14 | ^ | 15 | ^ | 16a | · | 16b | ^ | 17 | ^ | 18a | · | 18b |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | |||||||||||||||||||||||||||||||||||||||||||||
| SP2: | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP3: | - | - | |||||||||||||||||||||||||||||||||||||||||||||||
| SP4: | - | ||||||||||||||||||||||||||||||||||||||||||||||||
| SP5: | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP6: | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP7: | |||||||||||||||||||||||||||||||||||||||||||||||||
| SP8: | - |
Expression for ATXN7 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Neural Tube (Nervous System)
- Brain (Nervous System)
-
Colon (Gastrointestinal Tract)
This gene is overexpressed in Adipocyte (39.7) and Pancreatic juice (26.8).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ATXN7 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of ATXN7 Gene:
ATXN7SOURCE GeneReport for Unigene cluster for ATXN7 Gene:
Hs.476595mRNA Expression by UniProt/SwissProt for ATXN7 Gene:
O15265-ATX7_HUMAN
Tissue specificity:
Isoform a and isoform b are expressed in CNS, but isoform a is expressed predominantly in the peripherical tissues. Isoform b is also highly expressed in the frontal lobe, skeletal muscle and spinal cord and is expressed at a lower level in the lung, lymphoblast and intestine.
Evidence on tissue expression from TISSUES for ATXN7 Gene
- Intestine(4.2)
- Blood(4.1)
- Nervous system(2.8)
- Eye(2.2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for ATXN7 Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- digestive
- nervous
- skeletal muscle
Regions:
Head and neck:
- brain
- cerebellum
- cranial nerve
- eye
- face
- head
- mouth
- pharynx
Thorax:
- esophagus
Abdomen:
- stomach
Limb:
- foot
- lower limb
General:
- peripheral nerve
- peripheral nervous system
- spinal cord
Primer Products
-
OriGene qPCR primer pairs for ATXN7
Gene Expression Assay Products
No data available for mRNA differential expression in normal tissues for ATXN7 Gene
Orthologs for ATXN7 Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | ATXN7 33 34 |
|
||
| dog (Canis familiaris) |
Mammalia | ATXN7 34 33 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | ATXN7 33 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Atxn7 33 16 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Atxn7 33 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | -- 34 |
|
OneToMany | |
| -- 34 |
|
OneToMany | |||
| -- 34 |
|
OneToMany | |||
| oppossum (Monodelphis domestica) |
Mammalia | ATXN7 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | ATXN7 33 34 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | ATXN7 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | atxn7 33 |
|
||
| Str.19360 33 |
|
||||
| African clawed frog (Xenopus laevis) |
Amphibia | Xl.21192 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | LOC100001490 33 |
|
||
| ATXN7 34 |
|
OneToOne | |||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToMany |
- Species where no ortholog for ATXN7 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for ATXN7 Gene
(2) SIMAP similar genes for ATXN7 Gene using alignment to 2 proteins:
Variants for ATXN7 Gene
Polymorphic Variants from UniProtKB/Swiss-Prot for ATXN7 Gene
- ATX7_HUMAN-O15265
- The poly-Gln region of ATXN7 is highly polymorphic (4 to 18 repeats) in the normal population and is expanded to about 38-130 repeats in SCA7 patients. Intermediate alleles with 28 to 35 repeats are prone to further expansion.
| SNP ID | Clin | Chr 03 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs193922929 | pathogenic, likely-benign, Spinocerebellar ataxia 7, not specified | 63,912,685(+) | GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | coding_sequence_variant, genic_upstream_transcript_variant, inframe_deletion, inframe_insertion | |
| rs201561286 | benign, Abnormality of neuronal migration | 63,912,809(+) | T/C/G | coding_sequence_variant, genic_upstream_transcript_variant, missense_variant | |
| rs863223393 | benign, Abnormality of neuronal migration | 63,982,277(+) | G/A | coding_sequence_variant, missense_variant | |
| rs1053338 | likely-benign, not specified | 63,982,224(+) | A/G | coding_sequence_variant, missense_variant | |
| rs3733125 | likely-benign, not specified | 63,995,959(+) | C/T | coding_sequence_variant, synonymous_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| esv2725348 | CNV | deletion | 23290073 |
| esv32871 | CNV | loss | 17666407 |
| nsv1072697 | CNV | deletion | 25765185 |
| nsv1118974 | CNV | deletion | 24896259 |
| nsv3850 | CNV | deletion | 18451855 |
| nsv509828 | OTHER | sequence alteration | 20534489 |
| nsv954873 | CNV | duplication | 24416366 |
Residual Variation Intolerance Score:
13% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
12.38;
94.22% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for ATXN7 Gene
SNP Genotyping and Copy Number Assay Products
Disorders for ATXN7 Gene
(22) MalaCards diseases for ATXN7 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| spinocerebellar ataxia 7 |
|
|
| retinal degeneration |
|
|
| machado-joseph disease |
|
|
| hereditary ataxia |
|
|
| cerebellar disease |
|
|
Search ATXN7 in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
ATX7_HUMAN- Spinocerebellar ataxia 7 (SCA7) [MIM:164500]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA7 belongs to the autosomal dominant cerebellar ataxias type II (ADCA II) which are characterized by cerebellar ataxia with retinal degeneration and pigmentary macular dystrophy. {ECO:0000269 PubMed:9288099}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for ATXN7
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for ATXN7 Gene
Publications for ATXN7 Gene
- SUMOylation attenuates the aggregation propensity and cellular toxicity of the polyglutamine expanded ataxin-7. (PMID: 19843541) Janer A … Sittler A (Human molecular genetics 2010) 3 4 22 58
- Screening for premutation in the FMR1 gene in male patients suspected of spinocerebellar ataxia. (PMID: 19235102) Rajkiewicz M … Zaremba J (Neurologia i neurochirurgia polska 2008) 3 22 44 58
- Ataxin-7 is a subunit of GCN5 histone acetyltransferase-containing complexes. (PMID: 15115762) Helmlinger D … Devys D (Human molecular genetics 2004) 3 4 22 58
- A novel central nervous system-enriched spinocerebellar ataxia type 7 gene product. (PMID: 12533095) Einum DD … Fu YH (Archives of neurology 2003) 3 4 22 58
- Ataxin-7 interacts with a Cbl-associated protein that it recruits into neuronal intranuclear inclusions. (PMID: 11371513) Lebre AS … Brice A (Human molecular genetics 2001) 3 4 22 58
Products for ATXN7 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for ATXN7
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for ATXN7
- Search Origene for MassSpec and Protein Over-expression Lysates for ATXN7
- Origene Custom Protein Services for ATXN7
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ATXN7
- Browse OriGene Inhibitory RNA Products For ATXN7
- OriGene qPCR primer pairs for ATXN7
- OriGene CRISPR knockouts for ATXN7
- OriGene ORF clones in human for ATXN7
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For ATXN7
- GenScript: Next-day shipping of latest version cDNA ORF clones for ATXN7 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for ATXN7
- GenScript Custom Assay Services for ATXN7
- GenScript Custom overexpressing Cell Line Services for ATXN7
- GenScript: Design CRISPR guide RNA sequences for ATXN7
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for ATXN7
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for ATXN7
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for ATXN7
- Abcam proteins for ATXN7
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Cyagen custom Knockout/knockin (KOKI) mouse models for ATXN7
- VectorBuilder custom plasmid, inducible vectors for ATXN7
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ATXN7
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 53 available ATXN7 Antibodies ranked by validation data
- Compare Top ATXN7 Antibodies
- antibodies-online: Search results for available ATXN7 related products ranked by validation data
- antibodies-online: Search results for available ATXN7 related products ranked by validation data
- GeneTex ATXN7 antibody for ATXN7
- Search GeneTex for Proteins for ATXN7
- ViGene Biosciences adenoviral particle packaged cDNA for ATXN7 gene
- ViGene Biosciences lentiviral particle packaged cDNA for ATXN7 gene
- ViGene Biosciences ready-to-package AAV shRNAs for ATXN7 gene
- Search ViGene Biosciences for ATXN7
- Horizon Cell Lines for ATXN7
- genomics-online: cdna clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
- orf clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
- genomics-online: gRNA clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
- genomics-online: primer clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
- genomics-online: shRNA clones - Search results for 59 available ATXN7 gene related products
- Overview of 59 available ATXN7 gene related products
Sources for ATXN7 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems