Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ATXN7 Gene

Aliases for ATXN7 Gene

  • Ataxin 7 2 3 5
  • Spinocerebellar Ataxia Type 7 Protein 3 4
  • SCA7 3 4
  • Spinocerebellar Ataxia 7 (Olivopontocerebellar Atrophy With Retinal Degeneration) 2
  • Ataxin-7 3
  • ADCAII 3
  • OPCA3 3

External Ids for ATXN7 Gene

Previous HGNC Symbols for ATXN7 Gene

  • SCA7

Previous GeneCards Identifiers for ATXN7 Gene

  • GC03P063825

Summaries for ATXN7 Gene

Entrez Gene Summary for ATXN7 Gene

  • The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

GeneCards Summary for ATXN7 Gene

ATXN7 (Ataxin 7) is a Protein Coding gene. Diseases associated with ATXN7 include Spinocerebellar Ataxia 7 and Retinal Degeneration. Among its related pathways are Akt Signaling and Metabolism of proteins. Gene Ontology (GO) annotations related to this gene include chromatin binding. An important paralog of this gene is ATXN7L1.

UniProtKB/Swiss-Prot for ATXN7 Gene

  • Acts as component of the STAGA transcription coactivator-HAT complex. Mediates the interaction of STAGA complex with the CRX and is involved in CRX-dependent gene activation. Necessary for microtubule cytoskeleton stabilization.

Additional gene information for ATXN7 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ATXN7 Gene

Genomics for ATXN7 Gene

GeneHancer (GH) Regulatory Elements for ATXN7 Gene

Promoters and enhancers for ATXN7 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J063966 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 650.1 +105.3 105339 7.6 PKNOX1 FOXA2 ARID4B DMAP1 ZNF2 ZNF48 YY1 ZNF766 ZNF143 ATF7 ATXN7 PSMD6-AS2 THOC7 THOC7-AS1 SCAANT1
GH03J063910 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 650.2 +48.1 48096 4 ATF1 FOXA2 ARID4B SIN3A ZNF48 ETS1 YY1 GLIS2 ZNF207 ZNF143 SCAANT1 ATXN7 PSMD6-AS2 THOC7 THOC7-AS1 LOC100130345 ADAMTS9-AS2
GH03J063862 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 650.7 -0.6 -616 3.3 HDGF PKNOX1 ARNT ZNF2 ZNF48 GLIS2 ZNF143 SP3 MXD4 KAT8 ATXN7 THOC7 ENSG00000285399 PSMD6-AS2
GH03J063975 Promoter/Enhancer 1.7 EPDnew Ensembl ENCODE dbSUPER 657 +114.5 114487 8.3 SOX13 PKNOX1 SAP130 ZSCAN4 MAX FEZF1 CEBPG POLR2A FOS GATAD2A ATXN7 PSMD6-AS2 THOC7 THOC7-AS1 SCAANT1
GH03J064000 Promoter 0.7 EPDnew 650.1 +135.0 135033 0.1 GLIS1 ZIC2 ATXN7 PSMD6-AS2 SCAANT1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ATXN7 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ATXN7 gene promoter:

Genomic Locations for ATXN7 Gene

Genomic Locations for ATXN7 Gene
chr3:63,864,557-64,003,462
(GRCh38/hg38)
Size:
138,906 bases
Orientation:
Plus strand
chr3:63,850,233-63,989,138
(GRCh37/hg19)

Genomic View for ATXN7 Gene

Genes around ATXN7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ATXN7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ATXN7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ATXN7 Gene

Proteins for ATXN7 Gene

  • Protein details for ATXN7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O15265-ATX7_HUMAN
    Recommended name:
    Ataxin-7
    Protein Accession:
    O15265
    Secondary Accessions:
    • B4E207
    • E9PHP9
    • O75328
    • O75329
    • Q9Y6P8

    Protein attributes for ATXN7 Gene

    Size:
    892 amino acids
    Molecular mass:
    95451 Da
    Quaternary structure:
    • Component of the STAGA transcription coactivator-HAT complex, at least composed of SUPT3H, GCN5L2, TAF5L, TAF6L, SUPT7L, TADA3L, TAD1L, TAF10, TAF12, TRRAP, TAF9 and ATXN7. The STAGA core complex is associated with a subcomplex required for histone deubiquitination composed of ATXN7L3, ENY2 and USP22. Interacts with SORBS1, PSMC1 and CRX. Interacts with TRRAP, GCN5L2 and TAF10. Interacts with alpha tubulin.

    Three dimensional structures from OCA and Proteopedia for ATXN7 Gene

    Alternative splice isoforms for ATXN7 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ATXN7 Gene

Post-translational modifications for ATXN7 Gene

  • Proteolytically cleaved. The cleavage may be involved in SCA7 degeneration: the isoform fragments may exert distinct toxic influences that could contribute to selective neurodegeneration.
  • Sumoylation decreases the aggregation propensity and cellular toxicity of forms with an expanded poly-Gln region but has no effect on subcellular location or interaction with components of the STAGA complex.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ATXN7 Gene

No data available for DME Specific Peptides for ATXN7 Gene

Domains & Families for ATXN7 Gene

Gene Families for ATXN7 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for ATXN7 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for ATXN7 Gene

Graphical View of Domain Structure for InterPro Entry

O15265

UniProtKB/Swiss-Prot:

ATX7_HUMAN :
  • Belongs to the ataxin-7 family.
Family:
  • Belongs to the ataxin-7 family.
genes like me logo Genes that share domains with ATXN7: view

Function for ATXN7 Gene

Molecular function for ATXN7 Gene

UniProtKB/Swiss-Prot Function:
Acts as component of the STAGA transcription coactivator-HAT complex. Mediates the interaction of STAGA complex with the CRX and is involved in CRX-dependent gene activation. Necessary for microtubule cytoskeleton stabilization.

Phenotypes From GWAS Catalog for ATXN7 Gene

Gene Ontology (GO) - Molecular Function for ATXN7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 11371513
GO:0036459 thiol-dependent ubiquitinyl hydrolase activity TAS --
genes like me logo Genes that share ontologies with ATXN7: view
genes like me logo Genes that share phenotypes with ATXN7: view

Human Phenotype Ontology for ATXN7 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for ATXN7 Gene

Localization for ATXN7 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ATXN7 Gene

Isoform a: Nucleus. Nucleus, nucleolus. Nucleus matrix. Cytoplasm, cytoskeleton. Note=In addition to a diffuse distribution throughout the nucleus, it is associated with the nuclear matrix and the nucleolus. It is able to shuttle between the nucleus and cytoplasm.
Isoform b: Cytoplasm.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ATXN7 gene
Compartment Confidence
cytoskeleton 5
nucleus 5
cytosol 5
extracellular 1
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ATXN7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus TAS,IDA 22100762
GO:0005654 nucleoplasm TAS --
GO:0005730 nucleolus IEA --
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol IDA --
genes like me logo Genes that share ontologies with ATXN7: view

Pathways & Interactions for ATXN7 Gene

genes like me logo Genes that share pathways with ATXN7: view

Pathways by source for ATXN7 Gene

Gene Ontology (GO) - Biological Process for ATXN7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000226 microtubule cytoskeleton organization IMP 22100762
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006997 nucleus organization TAS 10441328
GO:0007601 visual perception TAS 9288099
genes like me logo Genes that share ontologies with ATXN7: view

No data available for SIGNOR curated interactions for ATXN7 Gene

Drugs & Compounds for ATXN7 Gene

(1) Drugs for ATXN7 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(1) Additional Compounds for ATXN7 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with ATXN7: view

Transcripts for ATXN7 Gene

mRNA/cDNA for ATXN7 Gene

Unigene Clusters for ATXN7 Gene

Ataxin 7:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ATXN7 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9a · 9b · 9c ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^ 16a · 16b ^ 17 ^ 18a · 18b
SP1: - - - -
SP2:
SP3: - -
SP4: -
SP5:
SP6:
SP7:
SP8: -

Relevant External Links for ATXN7 Gene

GeneLoc Exon Structure for
ATXN7
ECgene alternative splicing isoforms for
ATXN7

Expression for ATXN7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ATXN7 Gene

Protein differential expression in normal tissues from HIPED for ATXN7 Gene

This gene is overexpressed in Adipocyte (39.7) and Pancreatic juice (26.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ATXN7 Gene



Protein tissue co-expression partners for ATXN7 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ATXN7 Gene:

ATXN7

SOURCE GeneReport for Unigene cluster for ATXN7 Gene:

Hs.476595

mRNA Expression by UniProt/SwissProt for ATXN7 Gene:

O15265-ATX7_HUMAN
Tissue specificity: Isoform a and isoform b are expressed in CNS, but isoform a is expressed predominantly in the peripherical tissues. Isoform b is also highly expressed in the frontal lobe, skeletal muscle and spinal cord and is expressed at a lower level in the lung, lymphoblast and intestine.

Evidence on tissue expression from TISSUES for ATXN7 Gene

  • Intestine(4.2)
  • Blood(4.1)
  • Nervous system(2.8)
  • Eye(2.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ATXN7 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • digestive
  • nervous
  • skeletal muscle
Regions:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • eye
  • face
  • head
  • mouth
  • pharynx
Thorax:
  • esophagus
Abdomen:
  • stomach
Limb:
  • foot
  • lower limb
General:
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with ATXN7: view

No data available for mRNA differential expression in normal tissues for ATXN7 Gene

Orthologs for ATXN7 Gene

This gene was present in the common ancestor of chordates.

Orthologs for ATXN7 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ATXN7 33
  • 98.9 (n)
dog
(Canis familiaris)
Mammalia ATXN7 33
  • 92.72 (n)
cow
(Bos Taurus)
Mammalia ATXN7 33
  • 89.66 (n)
mouse
(Mus musculus)
Mammalia Atxn7 16 33
  • 86.18 (n)
rat
(Rattus norvegicus)
Mammalia Atxn7 33
  • 85.53 (n)
chicken
(Gallus gallus)
Aves ATXN7 33
  • 78.02 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia atxn7 33
  • 69.35 (n)
Str.19360 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.21192 33
zebrafish
(Danio rerio)
Actinopterygii LOC100001490 33
  • 58.95 (n)
Species where no ortholog for ATXN7 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ATXN7 Gene

ENSEMBL:
Gene Tree for ATXN7 (if available)
TreeFam:
Gene Tree for ATXN7 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ATXN7: view image

Paralogs for ATXN7 Gene

Paralogs for ATXN7 Gene

(2) SIMAP similar genes for ATXN7 Gene using alignment to 2 proteins:

  • ATX7_HUMAN
  • H0YAT6_HUMAN
genes like me logo Genes that share paralogs with ATXN7: view

Variants for ATXN7 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for ATXN7 Gene

ATX7_HUMAN-O15265
The poly-Gln region of ATXN7 is highly polymorphic (4 to 18 repeats) in the normal population and is expanded to about 38-130 repeats in SCA7 patients. Intermediate alleles with 28 to 35 repeats are prone to further expansion.

Sequence variations from dbSNP and Humsavar for ATXN7 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs193922929 pathogenic, likely-benign, Spinocerebellar ataxia 7, not specified 63,912,685(+) GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC coding_sequence_variant, genic_upstream_transcript_variant, inframe_deletion, inframe_insertion
rs201561286 benign, Abnormality of neuronal migration 63,912,809(+) T/C/G coding_sequence_variant, genic_upstream_transcript_variant, missense_variant
rs863223393 benign, Abnormality of neuronal migration 63,982,277(+) G/A coding_sequence_variant, missense_variant
rs1053338 likely-benign, not specified 63,982,224(+) A/G coding_sequence_variant, missense_variant
rs3733125 likely-benign, not specified 63,995,959(+) C/T coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for ATXN7 Gene

Variant ID Type Subtype PubMed ID
esv2725348 CNV deletion 23290073
esv32871 CNV loss 17666407
nsv1072697 CNV deletion 25765185
nsv1118974 CNV deletion 24896259
nsv3850 CNV deletion 18451855
nsv509828 OTHER sequence alteration 20534489
nsv954873 CNV duplication 24416366

Variation tolerance for ATXN7 Gene

Residual Variation Intolerance Score: 13% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 12.38; 94.22% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ATXN7 Gene

Human Gene Mutation Database (HGMD)
ATXN7
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ATXN7

SNP Genotyping and Copy Number Assay Products

Disorders for ATXN7 Gene

MalaCards: The human disease database

(22) MalaCards diseases for ATXN7 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
spinocerebellar ataxia 7
  • sca7
retinal degeneration
  • degeneration of retina
hereditary ataxia
  • ataxias hereditary
machado-joseph disease
  • mjd
cerebellar disease
  • cerebellar dysfunction
- elite association - COSMIC cancer census association via MalaCards
Search ATXN7 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

ATX7_HUMAN
  • Spinocerebellar ataxia 7 (SCA7) [MIM:164500]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA7 belongs to the autosomal dominant cerebellar ataxias type II (ADCA II) which are characterized by cerebellar ataxia with retinal degeneration and pigmentary macular dystrophy. {ECO:0000269 PubMed:9288099}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ATXN7

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ATXN7: view

No data available for Genatlas for ATXN7 Gene

Publications for ATXN7 Gene

  1. SUMOylation attenuates the aggregation propensity and cellular toxicity of the polyglutamine expanded ataxin-7. (PMID: 19843541) Janer A … Sittler A (Human molecular genetics 2010) 3 4 22 58
  2. Screening for premutation in the FMR1 gene in male patients suspected of spinocerebellar ataxia. (PMID: 19235102) Rajkiewicz M … Zaremba J (Neurologia i neurochirurgia polska 2008) 3 22 44 58
  3. Ataxin-7 is a subunit of GCN5 histone acetyltransferase-containing complexes. (PMID: 15115762) Helmlinger D … Devys D (Human molecular genetics 2004) 3 4 22 58
  4. A novel central nervous system-enriched spinocerebellar ataxia type 7 gene product. (PMID: 12533095) Einum DD … Fu YH (Archives of neurology 2003) 3 4 22 58
  5. Association of ataxin-7 with the proteasome subunit S4 of the 19S regulatory complex. (PMID: 11734547) Matilla A … Fu YH (Human molecular genetics 2001) 3 4 22 58

Products for ATXN7 Gene

Sources for ATXN7 Gene

Content
Loading form....