Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ASPN Gene

Aliases for ASPN Gene

  • Asporin 2 3 3 5
  • Asporin (LRR Class 1) 2 3
  • Asporin Proteoglycan 2 3
  • PLAP-1 3 4
  • SLRR1C 3 4
  • PLAP1 3 4
  • Periodontal Ligament Associated Protein 1 3
  • Periodontal Ligament-Associated Protein 1 4
  • Small Leucine-Rich Protein 1C 3
  • OS3 3

External Ids for ASPN Gene

Previous GeneCards Identifiers for ASPN Gene

  • GC09M086045
  • GC09M086946
  • GC09M088517
  • GC09M090559
  • GC09M092298
  • GC09M094258
  • GC09M095218
  • GC09M064895

Summaries for ASPN Gene

Entrez Gene Summary for ASPN Gene

  • This gene encodes a cartilage extracellular protein that is member of the small leucine-rich proteoglycan family. The encoded protein may regulate chondrogenesis by inhibiting transforming growth factor-beta 1-induced gene expression in cartilage. This protein also binds collagen and calcium and may induce collagen mineralization. Polymorphisms in the aspartic acid repeat region of this gene are associated with a susceptibility to osteoarthritis, and also with intervertebral disc disease. Alternative splicing of this gene results in multiple transcript variants.[provided by RefSeq, Jul 2014]

GeneCards Summary for ASPN Gene

ASPN (Asporin) is a Protein Coding gene. Diseases associated with ASPN include Intervertebral Disc Disease and Osteoarthritis. Among its related pathways are ECM proteoglycans and Degradation of the extracellular matrix. Gene Ontology (GO) annotations related to this gene include calcium ion binding and collagen binding. An important paralog of this gene is BGN.

UniProtKB/Swiss-Prot for ASPN Gene

  • Negatively regulates periodontal ligament (PDL) differentiation and mineralization to ensure that the PDL is not ossified and to maintain homeostasis of the tooth-supporting system. Inhibits BMP2-induced cytodifferentiation of PDL cells by preventing its binding to BMPR1B/BMP type-1B receptor, resulting in inhibition of BMP-dependent activation of SMAD proteins (By similarity). Critical regulator of TGF-beta in articular cartilage and plays an essential role in cartilage homeostasis and osteoarthritis (OA) pathogenesis. Negatively regulates chondrogenesis in the articular cartilage by blocking the TGF-beta/receptor interaction on the cell surface and inhibiting the canonical TGF-beta/Smad signal. Binds calcium and plays a role in osteoblast-driven collagen biomineralization activity.

Gene Wiki entry for ASPN Gene

Additional gene information for ASPN Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ASPN Gene

Genomics for ASPN Gene

GeneHancer (GH) Regulatory Elements for ASPN Gene

Promoters and enhancers for ASPN Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J092478 Promoter/Enhancer 1.6 EPDnew Ensembl ENCODE dbSUPER 650.7 +0.6 620 5.9 MXI1 PKNOX1 ARNT JUN MAX FEZF1 ZBTB40 BATF BCL11B FOSL1 ASPN CENPP OGN OMD
GH09J092533 Promoter/Enhancer 2 EPDnew Ensembl ENCODE dbSUPER 11 -53.4 -53400 4.3 PKNOX1 FOXA2 TAF1 HLF EBF1 MEF2B YY1 SP1 JUND GATA3 ECM2 CENPP ASPN OMD OGN IPPK BICD2 MIR4670
GH09J092504 Enhancer 1.1 Ensembl ENCODE dbSUPER 11.6 -24.0 -24043 4.4 CTCF SREBF2 MAX ZIC2 BRCA1 RAD21 FOSL1 POLR2A RCOR1 NFE2 CENPP ASPN MIR4670 ECM2
GH09J092384 Enhancer 0.7 ENCODE 10.4 +96.9 96915 2 PKNOX1 FOXA2 MAX YY1 ZNF316 POLR2A FOS MAFK RXRA CEBPB OGN NOL8 CENPP ASPN ECM2 LOC100420779
GH09J092440 Enhancer 0.6 ENCODE 10.6 +42.1 42059 0.9 PKNOX1 JUN ZFP64 JUNB ZC3H11A CEBPB ZNF781 ZNF518A ZNF697 ZNF217 NOL8 MTND4P15 OGN CENPP ZNF484 LOC100128076 IARS ASPN OMD
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ASPN on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ASPN gene promoter:
  • USF1
  • USF-1
  • Cdc5
  • RORalpha2
  • SRF
  • SRF (504 AA)
  • AML1a
  • POU3F2
  • POU3F2 (N-Oct-5a)

Genomic Locations for ASPN Gene

Genomic Locations for ASPN Gene
chr9:92,456,205-92,482,562
(GRCh38/hg38)
Size:
26,358 bases
Orientation:
Minus strand
chr9:95,218,487-95,244,844
(GRCh37/hg19)
Size:
26,358 bases
Orientation:
Minus strand

Genomic View for ASPN Gene

Genes around ASPN on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ASPN Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ASPN Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ASPN Gene

Proteins for ASPN Gene

  • Protein details for ASPN Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BXN1-ASPN_HUMAN
    Recommended name:
    Asporin
    Protein Accession:
    Q9BXN1
    Secondary Accessions:
    • Q5TBF3
    • Q96K79
    • Q96LD0
    • Q9NXP3

    Protein attributes for ASPN Gene

    Size:
    380 amino acids
    Molecular mass:
    43417 Da
    Quaternary structure:
    • Interacts with TGFB1, TGFB2 and TGFB3. DCN, BGN, and FMOD inhibit binding to TGFB1. Interacts with BMP2. Interacts in vitro with type II collagen (By similarity). Interacts with type I collagen. DCN can inhibit collagen binding.
    SequenceCaution:
    • Sequence=BAA90967.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

neXtProt entry for ASPN Gene

Post-translational modifications for ASPN Gene

  • There is no serine/glycine dipeptide sequence expected for the attachment of O-linked glycosaminoglycans and this is probably not a proteoglycan. The O-linked polysaccharide on 54-Ser is probably the mucin type linked to GalNAc.
  • The N-linked glycan at Asn-282 is composed of variable structures of GlcNAc, mannose, fucose, HexNAc and hexose.
  • Glycosylation at Asn282 and Ser55
  • Modification sites at PhosphoSitePlus

Other Protein References for ASPN Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ASPN Gene

Domains & Families for ASPN Gene

Gene Families for ASPN Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for ASPN Gene

Graphical View of Domain Structure for InterPro Entry

Q9BXN1

UniProtKB/Swiss-Prot:

ASPN_HUMAN :
  • The LRR 5 repeat can inhibit BMP2-induced cytodifferentiation and may be involved in the interaction with BMP2 (By similarity). The repeats LRR 10, LRR 11 and LRR 12 are involved in binding type I collagen. The poly-Asp region is involved in binding calcium.
  • Belongs to the small leucine-rich proteoglycan (SLRP) family. SLRP class I subfamily.
Domain:
  • The LRR 5 repeat can inhibit BMP2-induced cytodifferentiation and may be involved in the interaction with BMP2 (By similarity). The repeats LRR 10, LRR 11 and LRR 12 are involved in binding type I collagen. The poly-Asp region is involved in binding calcium.
Family:
  • Belongs to the small leucine-rich proteoglycan (SLRP) family. SLRP class I subfamily.
genes like me logo Genes that share domains with ASPN: view

Function for ASPN Gene

Molecular function for ASPN Gene

UniProtKB/Swiss-Prot Function:
Negatively regulates periodontal ligament (PDL) differentiation and mineralization to ensure that the PDL is not ossified and to maintain homeostasis of the tooth-supporting system. Inhibits BMP2-induced cytodifferentiation of PDL cells by preventing its binding to BMPR1B/BMP type-1B receptor, resulting in inhibition of BMP-dependent activation of SMAD proteins (By similarity). Critical regulator of TGF-beta in articular cartilage and plays an essential role in cartilage homeostasis and osteoarthritis (OA) pathogenesis. Negatively regulates chondrogenesis in the articular cartilage by blocking the TGF-beta/receptor interaction on the cell surface and inhibiting the canonical TGF-beta/Smad signal. Binds calcium and plays a role in osteoblast-driven collagen biomineralization activity.
UniProtKB/Swiss-Prot Induction:
By TGFB1.

Gene Ontology (GO) - Molecular Function for ASPN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004860 protein kinase inhibitor activity IBA --
GO:0005509 calcium ion binding IEA,IDA 19589127
GO:0005515 protein binding IEA --
GO:0005518 collagen binding IEA --
genes like me logo Genes that share ontologies with ASPN: view
genes like me logo Genes that share phenotypes with ASPN: view

Animal Models for ASPN Gene

MGI Knock Outs for ASPN:
  • Aspn Aspn<tm1b(EUCOMM)Hmgu>

Animal Model Products

  • Taconic Biosciences Mouse Models for ASPN

miRNA for ASPN Gene

miRTarBase miRNAs that target ASPN

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ASPN Gene

Localization for ASPN Gene

Subcellular locations from UniProtKB/Swiss-Prot for ASPN Gene

Secreted, extracellular space, extracellular matrix.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ASPN gene
Compartment Confidence
extracellular 5
nucleus 2
plasma membrane 1
cytoskeleton 1
mitochondrion 1
endoplasmic reticulum 1
cytosol 1
lysosome 1
golgi apparatus 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for ASPN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0005737 cytoplasm IBA --
GO:0031012 extracellular matrix IDA 27068509
genes like me logo Genes that share ontologies with ASPN: view

Pathways & Interactions for ASPN Gene

genes like me logo Genes that share pathways with ASPN: view

Pathways by source for ASPN Gene

2 Reactome pathways for ASPN Gene

Gene Ontology (GO) - Biological Process for ASPN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006469 negative regulation of protein kinase activity IBA --
GO:0019221 cytokine-mediated signaling pathway IBA --
GO:0030282 bone mineralization IDA 19589127
GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway IDA,IEA 17827158
GO:0031214 biomineral tissue development IEA --
genes like me logo Genes that share ontologies with ASPN: view

No data available for SIGNOR curated interactions for ASPN Gene

Drugs & Compounds for ASPN Gene

(1) Additional Compounds for ASPN Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with ASPN: view

Transcripts for ASPN Gene

mRNA/cDNA for ASPN Gene

(2) REFSEQ mRNAs :
(10) Additional mRNA sequences :
(120) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ASPN Gene

Asporin:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ASPN Gene

No ASD Table

Relevant External Links for ASPN Gene

GeneLoc Exon Structure for
ASPN
ECgene alternative splicing isoforms for
ASPN

Expression for ASPN Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ASPN Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for ASPN Gene

This gene is overexpressed in Artery - Aorta (x9.9), Artery - Coronary (x8.3), and Artery - Tibial (x4.4).

Protein differential expression in normal tissues from HIPED for ASPN Gene

This gene is overexpressed in Breast (23.7), Gallbladder (8.4), and Prostate (6.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ASPN Gene



Protein tissue co-expression partners for ASPN Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ASPN Gene:

ASPN

SOURCE GeneReport for Unigene cluster for ASPN Gene:

Hs.435655

mRNA Expression by UniProt/SwissProt for ASPN Gene:

Q9BXN1-ASPN_HUMAN
Tissue specificity: Higher levels in osteoarthritic articular cartilage, aorta, uterus. Moderate expression in small intestine, heart, liver, bladder, ovary, stomach, and in the adrenal, thyroid, and mammary glands. Low expression in trachea, bone marrow, and lung. Colocalizes with TGFB1 in chondrocytes within osteoarthritic (OA) lesions of articular cartilage.

Evidence on tissue expression from TISSUES for ASPN Gene

  • Heart(4.4)
  • Intestine(4.3)
  • Liver(4.3)
  • Muscle(2.2)
  • Nervous system(2)
genes like me logo Genes that share expression patterns with ASPN: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for ASPN Gene

Orthologs for ASPN Gene

This gene was present in the common ancestor of chordates.

Orthologs for ASPN Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ASPN 34 33
  • 99.65 (n)
OneToOne
cow
(Bos Taurus)
Mammalia ASPN 34 33
  • 89.95 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Aspn 16 34 33
  • 89.61 (n)
rat
(Rattus norvegicus)
Mammalia Aspn 33
  • 88.95 (n)
dog
(Canis familiaris)
Mammalia ASPN 34 33
  • 87.3 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ASPN 34
  • 84 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia ASPN 34
  • 81 (a)
OneToOne
chicken
(Gallus gallus)
Aves ASPN 34 33
  • 75.43 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ASPN 34
  • 78 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia aspn 33
  • 73.03 (n)
zebrafish
(Danio rerio)
Actinopterygii aspn 34 33
  • 60.31 (n)
OneToOne
Species where no ortholog for ASPN was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ASPN Gene

ENSEMBL:
Gene Tree for ASPN (if available)
TreeFam:
Gene Tree for ASPN (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ASPN: view image

Paralogs for ASPN Gene

Paralogs for ASPN Gene

(7) SIMAP similar genes for ASPN Gene using alignment to 6 proteins:

  • ASPN_HUMAN
  • C9JGC9_HUMAN
  • L0R6D0_HUMAN
  • Q05CQ6_HUMAN
  • Q5TBF2_HUMAN
  • Q6P528_HUMAN

Pseudogenes.org Pseudogenes for ASPN Gene

genes like me logo Genes that share paralogs with ASPN: view

Variants for ASPN Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for ASPN Gene

ASPN_HUMAN-Q9BXN1
The poly-Asp region of ASPN is polymorphic and ranges at least from 11 to 17 Asp (PubMed:11152692).

Sequence variations from dbSNP and Humsavar for ASPN Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs3078372 uncertain-significance, not specified 92,474,743(-) TCATCATCATCATCATCATCATCATCATCATCATCATCATCATC/TCATCATCATCATCATCATCATCATCATCATCATCATC/TCATCATCATCATCATCATCATCATCATCATCATCATCATC/TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC/TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC coding_sequence_variant
rs1000031047 -- 92,479,716(-) T/G intron_variant
rs1000034795 -- 92,480,031(-) T/C intron_variant
rs1000208110 -- 92,479,130(-) A/G intron_variant
rs1000293279 -- 92,464,688(-) T/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ASPN Gene

Variant ID Type Subtype PubMed ID
esv3621080 CNV loss 21293372
esv3621081 CNV loss 21293372
esv3891693 CNV gain 25118596
nsv1047337 CNV loss 25217958
nsv1049599 CNV loss 25217958

Variation tolerance for ASPN Gene

Gene Damage Index Score: 1.42; 27.95% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ASPN Gene

Human Gene Mutation Database (HGMD)
ASPN
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ASPN

SNP Genotyping and Copy Number Assay Products

Disorders for ASPN Gene

MalaCards: The human disease database

(9) MalaCards diseases for ASPN Gene - From: HGMD, OMIM, ClinVar, GTR, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
intervertebral disc disease
  • idd
osteoarthritis
  • kashin-beck disease
hypochondrogenesis
  • achondrogenesis type ii/hypochondrogenesis
torticollis
back pain
- elite association - COSMIC cancer census association via MalaCards
Search ASPN in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

ASPN_HUMAN
  • Osteoarthritis 3 (OS3) [MIM:607850]: A degenerative disease of the joints characterized by degradation of the hyaline articular cartilage and remodeling of the subchondral bone with sclerosis. Clinical symptoms include pain and joint stiffness often leading to significant disability and joint replacement. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry. Susceptibility to osteoarthritis is conferred by a triplet repeat expansion polymorphism. ASPN allele having 14 aspartic acid repeats in the N-terminal region of the protein (D14), is overrepresented relative to the common allele having 13 aspartic acid repeats (D13). The frequency of the D14 allele increases with disease severity. The D14 allele is also overrepresented in individuals with hip osteoarthritis.
  • Intervertebral disc disease (IDD) [MIM:603932]: A common musculo-skeletal disorder caused by degeneration of intervertebral disks of the lumbar spine. It results in low-back pain and unilateral leg pain. {ECO:0000269 PubMed:18304494}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry. Susceptibility to intervertebral disk disease, particularly lumbar disk degeneration, is conferred by a triplet repeat expansion polymorphism. ASPN allele having 14 aspartic acid repeats in the N-terminal region of the protein (D14), is associated with the disorder in some populations (PubMed:18304494). {ECO:0000269 PubMed:18304494}.

Additional Disease Information for ASPN

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ASPN: view

No data available for Genatlas for ASPN Gene

Publications for ASPN Gene

  1. Association of the asporin D14 allele with lumbar-disc degeneration in Asians. (PMID: 18304494) Song YQ … Chan D (American journal of human genetics 2008) 3 4 22 44 58
  2. Identification and characterization of asporin. a novel member of the leucine-rich repeat protein family closely related to decorin and biglycan. (PMID: 11152692) Lorenzo P … Heinegard D (The Journal of biological chemistry 2001) 2 3 4 22 58
  3. Association of an asporin repeat polymorphism with ankylosing spondylitis in Han Chinese population: a case-control study. (PMID: 20144272) Liu D … Zhang Y (Clinical and investigative medicine. Medecine clinique et experimentale 2010) 3 22 44 58
  4. Aspartic acid repeat polymorphism of the asporin gene with susceptibility to osteoarthritis of the knee in a Korean population. (PMID: 18178444) Song JH … Park WS (The Knee 2008) 3 22 44 58
  5. Absence of association of asporin polymorphisms and osteoarthritis susceptibility in US Caucasians. (PMID: 18434216) Atif U … Chiano M (Osteoarthritis and cartilage 2008) 3 22 44 58

Products for ASPN Gene

Sources for ASPN Gene

Content
Loading form....