Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ARMC9 Gene

Aliases for ARMC9 Gene

  • Armadillo Repeat Containing 9 2 3 5
  • Melanoma/Melanocyte-Specific Tumor Antigen KU-MEL-1 3 4
  • Armadillo Repeat-Containing Protein 9 3 4
  • LisH Domain-Containing Protein ARMC9 3 4
  • NS21 3 4
  • Melanoma/Melanocyte Specific Protein KU-MEL-1 3
  • Armadillo/Beta-Catenin-Like Repeats 3
  • KU-MEL-1 3
  • KIAA1868 4
  • JBTS30 3
  • ARM 3

External Ids for ARMC9 Gene

Previous GeneCards Identifiers for ARMC9 Gene

  • GC02P231889
  • GC02P231771
  • GC02P232064
  • GC02P223905

Summaries for ARMC9 Gene

GeneCards Summary for ARMC9 Gene

ARMC9 (Armadillo Repeat Containing 9) is a Protein Coding gene. Diseases associated with ARMC9 include Joubert Syndrome 30 and Joubert Syndrome 1. Gene Ontology (GO) annotations related to this gene include binding.

UniProtKB/Swiss-Prot for ARMC9 Gene

Gene Wiki entry for ARMC9 Gene

Additional gene information for ARMC9 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ARMC9 Gene

Genomics for ARMC9 Gene

GeneHancer (GH) Regulatory Elements for ARMC9 Gene

Promoters and enhancers for ARMC9 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ARMC9 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ARMC9 gene promoter:
  • AhR
  • FOXJ2
  • FOXJ2 (long isoform)
  • GATA-3
  • HNF-4alpha1
  • HNF-4alpha2
  • N-Myc
  • STAT1
  • STAT5A
  • TBP

Genomic Locations for ARMC9 Gene

Genomic Locations for ARMC9 Gene
chr2:231,198,546-231,394,991
(GRCh38/hg38)
Size:
196,446 bases
Orientation:
Plus strand
chr2:232,063,260-232,239,548
(GRCh37/hg19)
Size:
176,289 bases
Orientation:
Plus strand

Genomic View for ARMC9 Gene

Genes around ARMC9 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ARMC9 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ARMC9 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ARMC9 Gene

Proteins for ARMC9 Gene

  • Protein details for ARMC9 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q7Z3E5-ARMC9_HUMAN
    Recommended name:
    LisH domain-containing protein ARMC9
    Protein Accession:
    Q7Z3E5
    Secondary Accessions:
    • A0A087X1I8
    • Q53TI3
    • Q6P162
    • Q7L594
    • Q86WG2
    • Q96JF9
    • Q9H9R8

    Protein attributes for ARMC9 Gene

    Size:
    818 amino acids
    Molecular mass:
    91819 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAB14153.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Alternative splice isoforms for ARMC9 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ARMC9 Gene

Post-translational modifications for ARMC9 Gene

  • Ubiquitination at posLast=441441
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for ARMC9 Gene

Domains & Families for ARMC9 Gene

Gene Families for ARMC9 Gene

Protein Domains for ARMC9 Gene

Suggested Antigen Peptide Sequences for ARMC9 Gene

GenScript: Design optimal peptide antigens:
  • NS21 (ARMC9_HUMAN)

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ARMC9: view

No data available for UniProtKB/Swiss-Prot for ARMC9 Gene

Function for ARMC9 Gene

Molecular function for ARMC9 Gene

UniProtKB/Swiss-Prot Function:
Required for ciliogenesis.
UniProtKB/Swiss-Prot Induction:
Up-regulated in response to serum starvation in fibroblasts.

Phenotypes From GWAS Catalog for ARMC9 Gene

genes like me logo Genes that share phenotypes with ARMC9: view

Human Phenotype Ontology for ARMC9 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ARMC9

Clone Products

  • Applied Biological Materials (abm): Clones for ARMC9 - Now 50% OFF >
  • * ARMC9 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * ARMC9 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for ARMC9 Gene

Localization for ARMC9 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ARMC9 Gene

Cytoplasm, cytoskeleton, cilium basal body.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ARMC9 gene
Compartment Confidence
cytoskeleton 5
nucleus 2
cytosol 2
endoplasmic reticulum 1
lysosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoli (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ARMC9 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005856 cytoskeleton IEA --
GO:0036064 ciliary basal body IDA 28625504
GO:0042995 cell projection IEA --
GO:0070062 extracellular exosome HDA 19056867
genes like me logo Genes that share ontologies with ARMC9: view

Pathways & Interactions for ARMC9 Gene

PathCards logo

SuperPathways for ARMC9 Gene

No Data Available

Interacting Proteins for ARMC9 Gene

STRING Interaction Network Preview (showing top 2 STRING interactants - click image to see details)
https://version11.string-db.org/api/image/network?species=9606&limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000484804%0d9606.ENSP00000273963%0d9606.ENSP00000275815%0d
Selected Interacting proteins: ENSP00000484804 Q7Z3E5-ARMC9_HUMAN for ARMC9 Gene via STRING IID UniProtKB

Gene Ontology (GO) - Biological Process for ARMC9 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0030030 cell projection organization IEA --
GO:0060271 cilium assembly ISS --
genes like me logo Genes that share ontologies with ARMC9: view

No data available for Pathways by source and SIGNOR curated interactions for ARMC9 Gene

Drugs & Compounds for ARMC9 Gene

No Compound Related Data Available

Transcripts for ARMC9 Gene

Unigene Clusters for ARMC9 Gene

Armadillo repeat containing 9:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for ARMC9

Clone Products

  • Applied Biological Materials (abm): Clones for ARMC9 - Now 50% OFF >
  • * ARMC9 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * ARMC9 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for ARMC9 Gene

No ASD Table

Relevant External Links for ARMC9 Gene

GeneLoc Exon Structure for
ARMC9
ECgene alternative splicing isoforms for
ARMC9

Expression for ARMC9 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ARMC9 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for ARMC9 Gene

This gene is overexpressed in Esophagus - Muscularis (x4.8).

Protein differential expression in normal tissues from HIPED for ARMC9 Gene

This gene is overexpressed in Bone (65.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ARMC9 Gene



NURSA nuclear receptor signaling pathways regulating expression of ARMC9 Gene:

ARMC9

SOURCE GeneReport for Unigene cluster for ARMC9 Gene:

Hs.471610

mRNA Expression by UniProt/SwissProt for ARMC9 Gene:

Q7Z3E5-ARMC9_HUMAN
Tissue specificity: Strongly expressed in most melanomas and melanocytes. Weakly expressed in the testis.

Evidence on tissue expression from TISSUES for ARMC9 Gene

  • Nervous system(4.4)
  • Skin(4.2)
genes like me logo Genes that share expression patterns with ARMC9: view

No data available for Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for ARMC9 Gene

Orthologs for ARMC9 Gene

This gene was present in the common ancestor of animals.

Orthologs for ARMC9 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ARMC9 35 34
  • 99.19 (n)
OneToOne
cow
(Bos Taurus)
Mammalia ARMC9 35 34
  • 89.51 (n)
OneToOne
dog
(Canis familiaris)
Mammalia ARMC9 35 34
  • 87.04 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Armc9 17 35 34
  • 84.4 (n)
rat
(Rattus norvegicus)
Mammalia Armc9 34
  • 83.97 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 82 (a)
OneToMany
-- 35
  • 78 (a)
OneToMany
-- 35
  • 69 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia ARMC9 35
  • 70 (a)
OneToOne
chicken
(Gallus gallus)
Aves ARMC9 35 34
  • 71.81 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ARMC9 35
  • 64 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia armc9 34
  • 63.02 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC100334308 34
  • 62.3 (n)
armc9 35
  • 50 (a)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea F59G1.4 35
  • 17 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 53 (a)
OneToOne
Cin.13954 34
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.13954 34
Species where no ortholog for ARMC9 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ARMC9 Gene

ENSEMBL:
Gene Tree for ARMC9 (if available)
TreeFam:
Gene Tree for ARMC9 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ARMC9: view image

Paralogs for ARMC9 Gene

No data available for Paralogs for ARMC9 Gene

Variants for ARMC9 Gene

Sequence variations from dbSNP and Humsavar for ARMC9 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1114167447 pathogenic, ARMC9-related Joubert syndrome 231,206,294(+) G/T genic_upstream_transcript_variant, intron_variant
rs1114167448 pathogenic, ARMC9-related Joubert syndrome, JOUBERT SYNDROME 30 231,276,776(+) G/C splice_donor_variant
rs1114167449 pathogenic, ARMC9-related Joubert syndrome, JOUBERT SYNDROME 30, Joubert syndrome 30 (JBTS30) [MIM:617622] 231,282,066(+) C/T coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs1553611393 pathogenic, ARMC9-related Joubert syndrome, JOUBERT SYNDROME 30 231,272,951(+) TCAGGTCGCCTCTACCTTGCCCAGAACACAAAGGTGCTGCAGATGCTGGAGGGAAGGCTGAAGGAGGAGGACAAGGATATCATCACCAGGGAGAATGTTCTTGGGGCCCTGCAGAAGTTCAGTCTCAGGT/TCAGGT coding_sequence_variant, intron_variant, non_coding_transcript_variant, splice_acceptor_variant, splice_donor_variant
rs1553618510 uncertain-significance, ARMC9-related Joubert syndrome 231,296,245(+) GATGATGA/GATGA coding_sequence_variant, genic_downstream_transcript_variant, inframe_deletion, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for ARMC9 Gene

Variant ID Type Subtype PubMed ID
esv2277694 CNV deletion 18987734
esv2721611 CNV deletion 23290073
esv2721612 CNV deletion 23290073
nsv214398 CNV insertion 16902084
nsv475109 CNV novel sequence insertion 20440878
nsv512788 CNV insertion 21212237
nsv518307 CNV loss 19592680
nsv834566 CNV loss 17160897
nsv834567 CNV gain 17160897

Variation tolerance for ARMC9 Gene

Residual Variation Intolerance Score: 49.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.73; 57.66% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ARMC9 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
ARMC9
Human Gene Mutation Database (HGMD)
ARMC9

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ARMC9 Gene

Disorders for ARMC9 Gene

MalaCards: The human disease database

(6) MalaCards diseases for ARMC9 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
joubert syndrome 30
  • jbts30
joubert syndrome 1
  • jbts1
noonan syndrome 10
  • ns10
vogt-koyanagi-harada disease
  • harada's disease
mucopolysaccharidosis iii
  • sanfilippo syndrome a
- elite association - COSMIC cancer census association via MalaCards
Search ARMC9 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

ARMC9_HUMAN
  • Joubert syndrome 30 (JBTS30) [MIM:617622]: A form of Joubert syndrome, a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy, renal disease, liver fibrosis, and polydactyly. JBTS30 inheritance is autosomal recessive. {ECO:0000269 PubMed:28625504}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ARMC9

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ARMC9: view

No data available for Genatlas for ARMC9 Gene

Publications for ARMC9 Gene

  1. Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PMID: 11347906) Nagase T … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 2001) 2 3 4 58
  2. Mutations in ARMC9, which Encodes a Basal Body Protein, Cause Joubert Syndrome in Humans and Ciliopathy Phenotypes in Zebrafish. (PMID: 28625504) Van De Weghe JC … Doherty D (American journal of human genetics 2017) 3 4 58
  3. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 45 58
  4. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 45 58
  5. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier LW … Wilson RK (Nature 2005) 3 4 58

Products for ARMC9 Gene

Sources for ARMC9 Gene

Content
Loading form....