Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ARL2-SNX15 Gene

Subcategory (RNA class) for ARL2-SNX15 Gene


Quality Score for this RNA gene is


Aliases for ARL2-SNX15 Gene

  • ARL2-SNX15 Readthrough (NMD Candidate) 2 3 5

External Ids for ARL2-SNX15 Gene

Previous GeneCards Identifiers for ARL2-SNX15 Gene

  • GC11U901787
  • GC11P064783
  • GC11P064784

Summaries for ARL2-SNX15 Gene

Entrez Gene Summary for ARL2-SNX15 Gene

  • This locus represents naturally occurring read-through transcription between the neighboring ADP-ribosylation factor-like 2 (ARL2) and sorting nexin 15 (SNX15) genes on chromosome 11. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is therefore unlikely to produce a protein product. [provided by RefSeq, Dec 2010]

GeneCards Summary for ARL2-SNX15 Gene

ARL2-SNX15 (ARL2-SNX15 Readthrough (NMD Candidate)) is an RNA Gene, and is affiliated with the ncRNA class. Gene Ontology (GO) annotations related to this gene include GTP binding and obsolete signal transducer activity. An important paralog of this gene is ARL2.

Additional gene information for ARL2-SNX15 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ARL2-SNX15 Gene

Genomics for ARL2-SNX15 Gene

GeneHancer (GH) Regulatory Elements for ARL2-SNX15 Gene

Promoters and enhancers for ARL2-SNX15 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11J065012 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 650.7 +0.1 97 2.7 HDGF PKNOX1 CLOCK FOXA2 ARNT ARID4B SIN3A DMAP1 ZNF2 ZBTB7B ARL2 ARL2-SNX15 BATF2 ENSG00000257086 EIF1AD POLA2 PCNX3 ZFPL1 SF1 SSSCA1
GH11J065026 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 0.4 +13.6 13618 2 HDGF FOXA2 PKNOX1 CLOCK ARID4B SIN3A DMAP1 ZNF2 ZBTB7B YY1 SNX15 EEF1A1P18 EIF1AD PCNX3 SF1 POLA2 ZFPL1 ENSG00000257086 SART1 KAT5
GH11J064996 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 0.4 -15.9 -15946 3.9 HDGF CLOCK MLX ARID4B SIN3A DMAP1 YY1 CBX5 ZNF143 SP5 BATF2 ENSG00000269038 TRMT112 EHBP1L1 SPDYC EEF1A1P18 SAC3D1 SLC22A20P ARL2 ARL2-SNX15
GH11J065040 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 0.3 +27.0 27037 2.1 HDGF CLOCK MLX ARID4B SIN3A DMAP1 YY1 POLR2B ZNF143 DEK SAC3D1 KAT5 MUS81 SF1 DPF2 POLA2 SART1 RNASEH2C ZFPL1 PCNX3
GH11J065017 Promoter 0.7 EPDnew 0.7 +3.9 3876 0.1 ZNF507 ZKSCAN1 ARL2 MIR6879 MAJIN ARL2-SNX15
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ARL2-SNX15 on UCSC Golden Path with GeneCards custom track

Genomic Locations for ARL2-SNX15 Gene

Genomic Locations for ARL2-SNX15 Gene
26,460 bases
Plus strand
26,460 bases
Plus strand

Genomic View for ARL2-SNX15 Gene

Genes around ARL2-SNX15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ARL2-SNX15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ARL2-SNX15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ARL2-SNX15 Gene

Proteins for ARL2-SNX15 Gene

  • Protein details for ARL2-SNX15 Gene (UniProtKB/TrEMBL)

    Protein Symbol:
    Recommended name:
    ARL2-SNX15 readthrough (NMD candidate)
    Protein Accession:

    Protein attributes for ARL2-SNX15 Gene

    113 amino acids
    Molecular mass:
    13176 Da
    Quaternary structure:
    No Data Available

neXtProt entry for ARL2-SNX15 Gene

Post-translational modifications for ARL2-SNX15 Gene

No Post-translational modifications

Other Protein References for ARL2-SNX15 Gene

ENSEMBL proteins:

No data available for DME Specific Peptides for ARL2-SNX15 Gene

Domains & Families for ARL2-SNX15 Gene

Gene Families for ARL2-SNX15 Gene

  • Belongs to the small GTPase superfamily. Arf family.

Protein Domains for ARL2-SNX15 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ARL2-SNX15: view

No data available for Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for ARL2-SNX15 Gene

Function for ARL2-SNX15 Gene

Gene Ontology (GO) - Molecular Function for ARL2-SNX15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005525 GTP binding IEA --
genes like me logo Genes that share ontologies with ARL2-SNX15: view
genes like me logo Genes that share phenotypes with ARL2-SNX15: view

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for ARL2-SNX15 Gene

Localization for ARL2-SNX15 Gene

Gene Ontology (GO) - Cellular Components for ARL2-SNX15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
genes like me logo Genes that share ontologies with ARL2-SNX15: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Subcellular locations from the Human Protein Atlas (HPA) for ARL2-SNX15 Gene

Pathways & Interactions for ARL2-SNX15 Gene

SuperPathways for ARL2-SNX15 Gene

No Data Available

Interacting Proteins for ARL2-SNX15 Gene

Gene Ontology (GO) - Biological Process for ARL2-SNX15 Gene


No data available for Pathways by source and SIGNOR curated interactions for ARL2-SNX15 Gene

Drugs & Compounds for ARL2-SNX15 Gene

No Compound Related Data Available

Transcripts for ARL2-SNX15 Gene

mRNA/cDNA for ARL2-SNX15 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :
(1) RNA Central transcripts :

Alternative Splicing Database (ASD) splice patterns (SP) for ARL2-SNX15 Gene

No ASD Table

Relevant External Links for ARL2-SNX15 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ARL2-SNX15 Gene

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for ARL2-SNX15 Gene

Orthologs for ARL2-SNX15 Gene

This gene was present in the common ancestor of animals.

Orthologs for ARL2-SNX15 Gene

Organism Taxonomy Gene Similarity Type Details
(Canis familiaris)
Mammalia -- 34
  • 74 (a)
(Mus musculus)
Mammalia Arl2 34
  • 61 (a)
(Bos Taurus)
Mammalia ARL2 34
  • 61 (a)
(Monodelphis domestica)
Mammalia -- 34
  • 60 (a)
(Pan troglodytes)
Mammalia -- 34
  • 58 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 38 (a)
(Gallus gallus)
Aves -- 34
  • 28 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 52 (a)
(Danio rerio)
Actinopterygii arl2 34
  • 54 (a)
fruit fly
(Drosophila melanogaster)
Insecta Arf84F 34
  • 50 (a)
(Caenorhabditis elegans)
Secernentea evl-20 34
  • 41 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.2707 34
  • 54 (a)
Species where no ortholog for ARL2-SNX15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for ARL2-SNX15 Gene

Gene Tree for ARL2-SNX15 (if available)
Gene Tree for ARL2-SNX15 (if available)

Paralogs for ARL2-SNX15 Gene

genes like me logo Genes that share paralogs with ARL2-SNX15: view

Variants for ARL2-SNX15 Gene

Sequence variations from dbSNP and Humsavar for ARL2-SNX15 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1000042185 -- 65,014,790(+) T/G intron_variant
rs1000117241 -- 65,016,642(+) CCTGTGTGTGCCTGTGTGTGCC/CCTGTGTGTGCC intron_variant
rs1000145233 -- 65,040,295(+) G/A non_coding_transcript_variant
rs1000221831 -- 65,017,768(+) T/C intron_variant
rs1000278734 -- 65,022,366(+) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ARL2-SNX15 Gene

Variant ID Type Subtype PubMed ID
esv3626667 CNV loss 21293372
esv3626668 CNV gain 21293372
esv3626669 CNV gain 21293372
nsv1113400 CNV deletion 24896259
nsv1113401 CNV deletion 24896259
nsv1122633 CNV deletion 24896259
nsv526181 CNV gain 19592680
nsv983034 CNV duplication 23825009

Additional Variant Information for ARL2-SNX15 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for ARL2-SNX15 Gene

Disorders for ARL2-SNX15 Gene

Additional Disease Information for ARL2-SNX15

No disorders were found for ARL2-SNX15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ARL2-SNX15 Gene

Publications for ARL2-SNX15 Gene

  1. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. (PMID: 20967262) Prakash T … Taylor TD (PloS one 2010) 3 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58

Products for ARL2-SNX15 Gene

Sources for ARL2-SNX15 Gene

Loading form....