Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ARID3C Gene

Aliases for ARID3C Gene

  • AT-Rich Interaction Domain 3C 2 3 5
  • AT Rich Interactive Domain 3C (BRIGHT-Like) 2 3
  • ARID Domain-Containing Protein 3C 3 4
  • AT-Rich Interactive Domain-Containing Protein 3C 3
  • AT Rich Interactive Domain 3C (BRIGHT- Like) 2
  • Brightlike 3

External Ids for ARID3C Gene

Previous GeneCards Identifiers for ARID3C Gene

  • GC09U900405
  • GC09M034612
  • GC09M034613
  • GC09M034575

Summaries for ARID3C Gene

Entrez Gene Summary for ARID3C Gene

  • This gene is a member of the ARID (AT-rich interaction domain) family of proteins. The ARID domain is a helix-turn-helix motif-based DNA-binding domain. ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]

GeneCards Summary for ARID3C Gene

ARID3C (AT-Rich Interaction Domain 3C) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include chromatin binding. An important paralog of this gene is ARID3A.

Additional gene information for ARID3C Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ARID3C Gene

Genomics for ARID3C Gene

GeneHancer (GH) Regulatory Elements for ARID3C Gene

Promoters and enhancers for ARID3C Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J034628 Enhancer 0.7 Ensembl 650.7 -0.2 -189 1.1 CTCF SUZ12 SIN3A MCM2 ZNF48 ZFHX2 GLIS2 ZNF366 SCRT2 ZNF444 ARID3C ENSG00000230074 GALT SIGMAR1
GH09J034631 Enhancer 0.7 FANTOM5 650.7 -1.6 -1582 0.1 FOXA2 RXRA SP5 NR2F1 REST YY1 TEAD3 SP1 POLR2A PRDM10 ARID3C MYORG GALT SIGMAR1
GH09J034630 Enhancer 0.6 FANTOM5 650.7 -2.0 -1988 0.2 SP1 TAF1 HNF4A PRDM10 REST GABPA YY1 ARID3C DNAJB5 CNTFR ENHO PHF24 SIGMAR1
GH09J034575 Enhancer 0.8 FANTOM5 ENCODE 12.1 +50.7 50722 5.1 ZFHX2 POLR2A ZNF366 ZNF341 REST EZH2 EGR2 GC09P034580 GC09P034579 GALT RPP25L ENSG00000230074 ENHO FAM219A ENSG00000232983 ARID3C CNTFR
GH09J034675 Enhancer 0.8 ENCODE 11.2 -46.3 -46299 0.2 ELF3 RB1 ARID4B RAD21 RFX5 SLC30A9 ZNF614 ZNF143 RUNX3 THAP11 PIR49106 ENSG00000230074 IL11RA GALT CCL21 ARID3C LOC730098
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ARID3C on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ARID3C gene promoter:

Genomic Locations for ARID3C Gene

Genomic Locations for ARID3C Gene
chr9:34,621,286-34,628,950
(GRCh38/hg38)
Size:
7,665 bases
Orientation:
Minus strand
chr9:34,621,376-34,628,104
(GRCh37/hg19)

Genomic View for ARID3C Gene

Genes around ARID3C on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ARID3C Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ARID3C Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ARID3C Gene

Proteins for ARID3C Gene

  • Protein details for ARID3C Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A6NKF2-ARI3C_HUMAN
    Recommended name:
    AT-rich interactive domain-containing protein 3C
    Protein Accession:
    A6NKF2

    Protein attributes for ARID3C Gene

    Size:
    412 amino acids
    Molecular mass:
    44073 Da
    Quaternary structure:
    No Data Available

neXtProt entry for ARID3C Gene

Post-translational modifications for ARID3C Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ARID3C Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for ARID3C Gene

Domains & Families for ARID3C Gene

Gene Families for ARID3C Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for ARID3C Gene

Suggested Antigen Peptide Sequences for ARID3C Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ARID3C: view

No data available for UniProtKB/Swiss-Prot for ARID3C Gene

Function for ARID3C Gene

Gene Ontology (GO) - Molecular Function for ARID3C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000977 RNA polymerase II regulatory region sequence-specific DNA binding IBA --
GO:0001228 transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding IBA --
GO:0003677 DNA binding IEA --
GO:0003682 chromatin binding IEA --
genes like me logo Genes that share ontologies with ARID3C: view
genes like me logo Genes that share phenotypes with ARID3C: view

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for ARID3C Gene

Localization for ARID3C Gene

Subcellular locations from UniProtKB/Swiss-Prot for ARID3C Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ARID3C gene
Compartment Confidence
nucleus 4
mitochondrion 1
endoplasmic reticulum 1
cytosol 1

Gene Ontology (GO) - Cellular Components for ARID3C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IBA --
GO:0005737 cytoplasm IEA --
GO:0045121 membrane raft IDA 21955986
genes like me logo Genes that share ontologies with ARID3C: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for ARID3C Gene

Pathways & Interactions for ARID3C Gene

SuperPathways for ARID3C Gene

No Data Available

Interacting Proteins for ARID3C Gene

Gene Ontology (GO) - Biological Process for ARID3C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006366 transcription by RNA polymerase II IEA --
GO:0045944 positive regulation of transcription by RNA polymerase II IEA --
genes like me logo Genes that share ontologies with ARID3C: view

No data available for Pathways by source and SIGNOR curated interactions for ARID3C Gene

Drugs & Compounds for ARID3C Gene

No Compound Related Data Available

Transcripts for ARID3C Gene

mRNA/cDNA for ARID3C Gene

(0) Additional mRNA sequences :
-
(2) REFSEQ mRNAs :
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ARID3C Gene

AT rich interactive domain 3C (BRIGHT-like):
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ARID3C Gene

No ASD Table

Relevant External Links for ARID3C Gene

GeneLoc Exon Structure for
ARID3C
ECgene alternative splicing isoforms for
ARID3C

Expression for ARID3C Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ARID3C Gene

mRNA differential expression in normal tissues according to GTEx for ARID3C Gene

This gene is overexpressed in Liver (x16.6).

Protein differential expression in normal tissues from HIPED for ARID3C Gene

This gene is overexpressed in Skin (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ARID3C Gene



Protein tissue co-expression partners for ARID3C Gene

NURSA nuclear receptor signaling pathways regulating expression of ARID3C Gene:

ARID3C

SOURCE GeneReport for Unigene cluster for ARID3C Gene:

Hs.534549
genes like me logo Genes that share expression patterns with ARID3C: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for ARID3C Gene

Orthologs for ARID3C Gene

This gene was present in the common ancestor of animals.

Orthologs for ARID3C Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ARID3C 34 33
  • 99.57 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ARID3C 34
  • 88 (a)
OneToOne
dog
(Canis familiaris)
Mammalia ARID3C 34 33
  • 87.12 (n)
OneToOne
cow
(Bos Taurus)
Mammalia ARID3C 34 33
  • 85.7 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Arid3c 33
  • 83.21 (n)
mouse
(Mus musculus)
Mammalia Arid3c 16 34 33
  • 82.32 (n)
oppossum
(Monodelphis domestica)
Mammalia ARID3C 34
  • 63 (a)
OneToOne
chicken
(Gallus gallus)
Aves ARID3C 34
  • 46 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ARID3C 34
  • 51 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii ARID3C 34
  • 34 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta retn 34
  • 19 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea cfi-1 34
  • 28 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.6971 34
  • 28 (a)
OneToMany
Species where no ortholog for ARID3C was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for ARID3C Gene

ENSEMBL:
Gene Tree for ARID3C (if available)
TreeFam:
Gene Tree for ARID3C (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ARID3C: view image

Paralogs for ARID3C Gene

Paralogs for ARID3C Gene

(2) SIMAP similar genes for ARID3C Gene using alignment to 1 proteins:

  • ARI3C_HUMAN
genes like me logo Genes that share paralogs with ARID3C: view

Variants for ARID3C Gene

Sequence variations from dbSNP and Humsavar for ARID3C Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs1000222849 -- 34,634,015(-) ACT/ upstream_transcript_variant
rs1000284556 -- 34,623,572(-) G/A/C coding_sequence_variant, missense_variant
rs1000447387 -- 34,628,473(-) AGGCAGAGGTATCAGGCAGAG/AGGCAGAG genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000729035 -- 34,634,301(-) C/A upstream_transcript_variant
rs1000867464 -- 34,624,492(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ARID3C Gene

Variant ID Type Subtype PubMed ID
dgv12659n54 CNV loss 21841781
esv3620335 CNV gain 21293372
nsv1125318 OTHER inversion 24896259
nsv1161857 CNV deletion 26073780
nsv471997 CNV novel sequence insertion 20440878
nsv818699 CNV gain 17921354

Variation tolerance for ARID3C Gene

Residual Variation Intolerance Score: 62.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.75; 66.53% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ARID3C Gene

Human Gene Mutation Database (HGMD)
ARID3C
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ARID3C

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ARID3C Gene

Disorders for ARID3C Gene

Additional Disease Information for ARID3C

No disorders were found for ARID3C Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ARID3C Gene

Publications for ARID3C Gene

  1. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  2. Characterization of a new ARID family transcription factor (Brightlike/ARID3C) that co-activates Bright/ARID3A-mediated immunoglobulin gene transcription. (PMID: 21955986) Tidwell JA … Tucker PW (Molecular immunology 2011) 3 58
  3. REKLES is an ARID3-restricted multifunctional domain. (PMID: 17400556) Kim D … Tucker PW (The Journal of biological chemistry 2007) 4 58
  4. Nomenclature of the ARID family of DNA-binding proteins. (PMID: 15922553) Wilsker D … Moran E (Genomics 2005) 3 58
  5. DNA sequence and analysis of human chromosome 9. (PMID: 15164053) Humphray SJ … Dunham I (Nature 2004) 4 58

Products for ARID3C Gene

Sources for ARID3C Gene

Content
Loading form....