Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ARID1A Gene

Aliases for ARID1A Gene

  • AT-Rich Interaction Domain 1A 2 3 5
  • SWI/SNF-Related, Matrix-Associated, Actin-Dependent Regulator Of Chromatin Subfamily F Member 1 3 4
  • AT-Rich Interactive Domain-Containing Protein 1A 3 4
  • AT Rich Interactive Domain 1A (SWI-Like) 2 3
  • ARID Domain-Containing Protein 1A 3 4
  • SWI/SNF Complex Protein P270 3 4
  • BRG1-Associated Factor 250a 3 4
  • SWI-Like Protein 3 4
  • Osa Homolog 1 3 4
  • SMARCF1 3 4
  • C1orf4 3 4
  • BAF250 3 4
  • HOSA1 3 4
  • B120 3 4
  • OSA1 3 4
  • HELD 3 4
  • SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily F, Member 1 2
  • AT Rich Interactive Domain 1A (SWI- Like) 2
  • Chromatin Remodeling Factor P250 3
  • BRG1-Associated Factor 250 4
  • OSA1 Nuclear Protein 3
  • Brain Protein 120 3
  • BAF250a 3
  • BAF250A 4
  • BM029 3
  • MRD14 3
  • CSS2 3
  • P270 3
  • ELD 3

External Ids for ARID1A Gene

Previous HGNC Symbols for ARID1A Gene

  • C1orf4
  • SMARCF1

Previous GeneCards Identifiers for ARID1A Gene

  • GC01P026627
  • GC01P026895
  • GC01P027022
  • GC01P025309

Summaries for ARID1A Gene

Entrez Gene Summary for ARID1A Gene

  • This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

CIViC summary for ARID1A Gene

GeneCards Summary for ARID1A Gene

ARID1A (AT-Rich Interaction Domain 1A) is a Protein Coding gene. Diseases associated with ARID1A include Coffin-Siris Syndrome 2 and Coffin-Siris Syndrome 1. Among its related pathways are PEDF Induced Signaling and Chromatin Regulation / Acetylation. Gene Ontology (GO) annotations related to this gene include binding and nuclear receptor binding. An important paralog of this gene is ARID1B.

UniProtKB/Swiss-Prot for ARID1A Gene

  • Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).

Gene Wiki entry for ARID1A Gene

Additional gene information for ARID1A Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ARID1A Gene

Genomics for ARID1A Gene

GeneHancer (GH) Regulatory Elements for ARID1A Gene

Promoters and enhancers for ARID1A Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around ARID1A on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ARID1A gene promoter:
  • AREB6
  • E2F
  • E2F-1
  • E2F-2
  • E2F-3a
  • E2F-4
  • E2F-5
  • GATA-1
  • p53
  • Pax-4a

Genomic Locations for ARID1A Gene

Genomic Locations for ARID1A Gene
chr1:26,693,236-26,782,110
(GRCh38/hg38)
Size:
88,875 bases
Orientation:
Plus strand
chr1:27,022,522-27,108,601
(GRCh37/hg19)
Size:
86,080 bases
Orientation:
Plus strand

Genomic View for ARID1A Gene

Genes around ARID1A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ARID1A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ARID1A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ARID1A Gene

Proteins for ARID1A Gene

  • Protein details for ARID1A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O14497-ARI1A_HUMAN
    Recommended name:
    AT-rich interactive domain-containing protein 1A
    Protein Accession:
    O14497
    Secondary Accessions:
    • D3DPL1
    • Q53FK9
    • Q5T0W1
    • Q5T0W2
    • Q5T0W3
    • Q8NFD6
    • Q96T89
    • Q9BY33
    • Q9HBJ5
    • Q9UPZ1

    Protein attributes for ARID1A Gene

    Size:
    2285 amino acids
    Molecular mass:
    242045 Da
    Quaternary structure:
    • Component of SWI/SNF chromatin remodeling complexes, in some of which it can be mutually exclusive with ARID1B/BAF250B. The canonical complex contains a catalytic subunit (either SMARCA4/BRG1/BAF190A or SMARCA2/BRM/BAF190B) and at least SMARCE1, ACTL6A/BAF53, SMARCC1/BAF155, SMARCC2/BAF170, and SMARCB1/SNF5/BAF47. Other subunits specific to each of the complexes may also be present permitting several possible combinations developmentally and tissue specific (PubMed:22952240, PubMed:26601204, PubMed:12200431, PubMed:8804307, PubMed:11780067, PubMed:11988099, PubMed:15170388). Component of the BAF (SWI/SNF-A) complex, which includes at least actin (ACTB), ARID1A/BAF250A, ARID1B/BAF250B, SMARCA2/BRM, SMARCA4/BRG1/BAF190A, ACTL6A/BAF53, ACTL6B/BAF53B, SMARCE1/BAF57, SMARCC1/BAF155, SMARCC2/BAF170, SMARCB1/SNF5/INI1, and one or more SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C (PubMed:12200431, PubMed:11734557, PubMed:18765789,). In muscle cells, the BAF complex also contains DPF3. Component of neural progenitors-specific chromatin remodeling complex (npBAF complex) composed of at least, ARID1A/BAF250A or ARID1B/BAF250B, SMARCD1/BAF60A, SMARCD3/BAF60C, SMARCA2/BRM/BAF190B, SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, SMARCC1/BAF155, SMARCE1/BAF57, SMARCC2/BAF170, PHF10/BAF45A, ACTL6A/BAF53A and actin. Component of neuron-specific chromatin remodeling complex (nBAF complex) composed of at least, ARID1A/BAF250A or ARID1B/BAF250B, SMARCD1/BAF60A, SMARCD3/BAF60C, SMARCA2/BRM/BAF190B, SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, SMARCC1/BAF155, SMARCE1/BAF57, SMARCC2/BAF170, DPF1/BAF45B, DPF3/BAF45C, ACTL6B/BAF53B and actin (By similarity). Component of a SWI/SNF-like EBAFa complex, at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47/SNF5, ACTL6A/BAF53A, SMARCE1/BAF57, SMARCD1/BAF60A, SMARCC1/BAF155, SMARCC2/BAF170, BAF250A and MLLT1/ENL (PubMed:12665591). Interacts through its C-terminus with SMARCA2/BRM/BAF190B and SMARCA4/BRG1/BAF190A (PubMed:12200431, PubMed:15170388). Interacts with SMARCC1/BAF155 (PubMed:15170388).
    SequenceCaution:
    • Sequence=AAF75765.1; Type=Frameshift; Positions=374; Evidence={ECO:0000305}; Sequence=AAG33967.1; Type=Frameshift; Positions=872, 885; Evidence={ECO:0000305}; Sequence=BAA23269.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305}; Sequence=BAA83073.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=BAA83073.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for ARID1A Gene

    Alternative splice isoforms for ARID1A Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ARID1A Gene

Post-translational modifications for ARID1A Gene

  • Ubiquitination at isoforms=2, 31662 and isoforms=2, 31201
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for ARID1A Gene

Domains & Families for ARID1A Gene

Gene Families for ARID1A Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for ARID1A Gene

GenScript: Design optimal peptide antigens:
  • ARID1A protein (A4FU79_HUMAN)
  • hELD (ARI1A_HUMAN)
  • ARID1A (C1KEN7_HUMAN)
  • AT rich interactive domain 1A (SWI-like) (Q5JYH3_HUMAN)
  • cDNA FLJ14749 fis, clone NT2RP3002876, weakly similar to Drosophila melanogaster eyelid (eld) mRNA (Q96SM7_HUMAN)

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ARID1A: view

No data available for UniProtKB/Swiss-Prot for ARID1A Gene

Function for ARID1A Gene

Molecular function for ARID1A Gene

UniProtKB/Swiss-Prot Function:
Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).

Phenotypes From GWAS Catalog for ARID1A Gene

Gene Ontology (GO) - Molecular Function for ARID1A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific ISA --
GO:0003677 DNA binding NAS,IEA 10757798
GO:0003713 transcription coactivator activity NAS 8804307
GO:0005515 protein binding IPI 11780067
GO:0016922 nuclear receptor binding IPI 17363140
genes like me logo Genes that share ontologies with ARID1A: view
genes like me logo Genes that share phenotypes with ARID1A: view

Human Phenotype Ontology for ARID1A Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ARID1A Gene

MGI Knock Outs for ARID1A:

Animal Model Products

CRISPR Products

miRNA for ARID1A Gene

miRTarBase miRNAs that target ARID1A

Clone Products

  • Applied Biological Materials (abm): Clones for ARID1A - Now 50% OFF >
  • * ARID1A as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * ARID1A tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for ARID1A Gene

Localization for ARID1A Gene

Subcellular locations from UniProtKB/Swiss-Prot for ARID1A Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ARID1A gene
Compartment Confidence
nucleus 5
cytoskeleton 1
cytosol 1
plasma membrane 0
extracellular 0
peroxisome 0
endoplasmic reticulum 0

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for ARID1A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000790 nuclear chromatin IDA 17363140
GO:0005634 nucleus TAS,IEA 12200431
GO:0005654 nucleoplasm IDA --
GO:0016514 SWI/SNF complex IEA,IDA 8804307
GO:0035060 brahma complex IEA --
genes like me logo Genes that share ontologies with ARID1A: view

Pathways & Interactions for ARID1A Gene

genes like me logo Genes that share pathways with ARID1A: view

Pathways by source for ARID1A Gene

Gene Ontology (GO) - Biological Process for ARID1A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IEA --
GO:0001704 formation of primary germ layer IEA --
GO:0001843 neural tube closure IEA --
GO:0003205 cardiac chamber development IEA --
GO:0003408 optic cup formation involved in camera-type eye development IEA --
genes like me logo Genes that share ontologies with ARID1A: view

No data available for SIGNOR curated interactions for ARID1A Gene

Drugs & Compounds for ARID1A Gene

No Compound Related Data Available

Transcripts for ARID1A Gene

mRNA/cDNA for ARID1A Gene

Unigene Clusters for ARID1A Gene

AT rich interactive domain 1A (SWI-like):
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for ARID1A - Now 50% OFF >
  • * ARID1A as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * ARID1A tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for ARID1A Gene

ExUns: 1 ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b ^ 15a · 15b · 15c ^ 16 ^ 17a · 17b ^ 18 ^ 19a ·
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:
SP11: -
SP12:
SP13:

ExUns: 19b · 19c · 19d ^ 20 ^ 21 ^ 22a · 22b ^ 23 ^ 24
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9: - -
SP10:
SP11:
SP12:
SP13:

Relevant External Links for ARID1A Gene

GeneLoc Exon Structure for
ARID1A
ECgene alternative splicing isoforms for
ARID1A

Expression for ARID1A Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ARID1A Gene

Protein differential expression in normal tissues from HIPED for ARID1A Gene

This gene is overexpressed in Peripheral blood mononuclear cells (12.9), CD8 Tcells (10.6), and Monocytes (6.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for ARID1A Gene



Protein tissue co-expression partners for ARID1A Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ARID1A Gene:

ARID1A

SOURCE GeneReport for Unigene cluster for ARID1A Gene:

Hs.468972

mRNA Expression by UniProt/SwissProt for ARID1A Gene:

O14497-ARI1A_HUMAN
Tissue specificity: Highly expressed in spleen, thymus, prostate, testis, ovary, small intestine, colon, and PBL, and at a much lower level in heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas.

Evidence on tissue expression from TISSUES for ARID1A Gene

  • Nervous system(4.8)
  • Liver(4.4)
  • Stomach(4.4)
  • Intestine(3)
  • Blood(2.3)
  • Muscle(2.3)
  • Lung(2.2)
  • Lymph node(2.2)
  • Heart(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ARID1A Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cerebellum
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • outer ear
  • pharynx
  • scalp
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • diaphragm
  • esophagus
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • abdominal wall
  • biliary tract
  • duodenum
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • stomach
Pelvis:
  • pelvis
  • penis
  • rectum
  • testicle
  • ureter
  • urethra
  • uterus
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • nail
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • hair
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with ARID1A: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for ARID1A Gene

Orthologs for ARID1A Gene

This gene was present in the common ancestor of animals.

Orthologs for ARID1A Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ARID1A 35 34
  • 99.74 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 96 (a)
OneToMany
-- 35
  • 89 (a)
OneToMany
-- 35
  • 75 (a)
OneToMany
-- 35
  • 65 (a)
OneToMany
dog
(Canis familiaris)
Mammalia ARID1A 35 34
  • 95.22 (n)
OneToOne
cow
(Bos Taurus)
Mammalia ARID1A 35 34
  • 94.02 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Arid1a 17 35 34
  • 92.07 (n)
oppossum
(Monodelphis domestica)
Mammalia ARID1A 35
  • 92 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Arid1a 34
  • 91.94 (n)
chicken
(Gallus gallus)
Aves -- 35
  • 83 (a)
OneToMany
ARID1A 34
  • 80.54 (n)
-- 35
  • 48 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia ARID1A 35
  • 85 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia arid1a 34
  • 70.83 (n)
zebrafish
(Danio rerio)
Actinopterygii arid1ab 34 35
  • 69.09 (n)
arid1aa 35
  • 61 (a)
OneToMany
Dr.26931 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.12620 34
fruit fly
(Drosophila melanogaster)
Insecta osa 35
  • 25 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea let-526 35
  • 22 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.335 35
  • 47 (a)
OneToOne
Species where no ortholog for ARID1A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ARID1A Gene

ENSEMBL:
Gene Tree for ARID1A (if available)
TreeFam:
Gene Tree for ARID1A (if available)
Aminode:
Evolutionary constrained regions (ECRs) for ARID1A: view image

Paralogs for ARID1A Gene

Paralogs for ARID1A Gene

(2) SIMAP similar genes for ARID1A Gene using alignment to 8 proteins:

  • ARI1A_HUMAN
  • A4FU79_HUMAN
  • C1KEN7_HUMAN
  • E9PQW6_HUMAN
  • H0Y488_HUMAN
  • H0YCU6_HUMAN
  • H0YEW5_HUMAN
  • Q96SM7_HUMAN
genes like me logo Genes that share paralogs with ARID1A: view

Variants for ARID1A Gene

Sequence variations from dbSNP and Humsavar for ARID1A Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1485978447 pathogenic, Mental retardation, autosomal dominant 14 26,779,062(+) C/A/T coding_sequence_variant, stop_gained, synonymous_variant
rs150076443 uncertain-significance, Inborn genetic diseases 26,779,545(+) A/T coding_sequence_variant, missense_variant
rs150534917 likely-benign, uncertain-significance, not specified, not provided 26,779,389(+) C/G coding_sequence_variant, missense_variant
rs1553146165 pathogenic, Mental retardation, autosomal dominant 14 26,697,317(+) CCCGGGGCTACCAGGGCTACCCCGGGG/CCCGGGG coding_sequence_variant, frameshift
rs1553149467 association, Colorectal cancer 26,731,454(+) C/G coding_sequence_variant, stop_gained

Structural Variations from Database of Genomic Variants (DGV) for ARID1A Gene

Variant ID Type Subtype PubMed ID
dgv67n106 CNV deletion 24896259
esv275548 CNV loss 21479260
nsv1000012 CNV gain 25217958
nsv1075762 CNV deletion 25765185
nsv1133826 CNV deletion 24896259
nsv7523 CNV deletion 18451855
nsv950340 CNV deletion 24416366
nsv950341 CNV duplication 24416366

Variation tolerance for ARID1A Gene

Residual Variation Intolerance Score: 0.602% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.24; 62.36% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ARID1A Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
ARID1A
Human Gene Mutation Database (HGMD)
ARID1A

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ARID1A Gene

Disorders for ARID1A Gene

MalaCards: The human disease database

(27) MalaCards diseases for ARID1A Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

ARI1A_HUMAN
  • Coffin-Siris syndrome 2 (CSS2) [MIM:614607]: A form of Coffin-Siris syndrome, a congenital multiple malformation syndrome with broad phenotypic and genetic variability. Cardinal features are intellectual disability, coarse facial features, hypertrichosis, and hypoplastic or absent fifth digit nails or phalanges. Additional features include malformations of the cardiac, gastrointestinal, genitourinary, and/or central nervous systems. Sucking/feeding difficulties, poor growth, ophthalmologic abnormalities, hearing impairment, and spinal anomalies are common findings. Both autosomal dominant and autosomal recessive inheritance patterns have been reported. {ECO:0000269 PubMed:22426308}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ARID1A

genes like me logo Genes that share disorders with ARID1A: view

No data available for Genatlas for ARID1A Gene

Publications for ARID1A Gene

  1. Characterization of mammalian orthologues of the Drosophila osa gene: cDNA cloning, expression, chromosomal localization, and direct physical interaction with Brahma chromatin-remodeling complex. (PMID: 11318604) Kozmik Z … Vlcek C (Genomics 2001) 3 4 23 58
  2. The human SWI-SNF complex protein p270 is an ARID family member with non-sequence-specific DNA binding activity. (PMID: 10757798) Dallas PB … Moran E (Molecular and cellular biology 2000) 3 4 23 58
  3. Molecular cloning and expression of a novel human cDNA containing CAG repeats. (PMID: 9434167) Takeuchi T … Ohtsuki Y (Gene 1997) 2 3 4 58
  4. Identification and functional characterization of a novel bipartite nuclear localization sequence in ARID1A. (PMID: 26614907) Bateman NW … Conrads TP (Biochemical and biophysical research communications 2016) 3 4 58
  5. A comprehensive molecular study on Coffin-Siris and Nicolaides-Baraitser syndromes identifies a broad molecular and clinical spectrum converging on altered chromatin remodeling. (PMID: 23906836) Wieczorek D … Wollnik B (Human molecular genetics 2013) 3 4 58

Products for ARID1A Gene