Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AP2M1 Gene

Aliases for AP2M1 Gene

  • Adaptor Related Protein Complex 2 Subunit Mu 1 2 3
  • Adaptor Related Protein Complex 2 Mu 1 Subunit 2 3 5
  • Clathrin-Associated/Assembly/Adaptor Protein, Medium 1 2 3
  • Clathrin Assembly Protein Complex 2 Mu Medium Chain 3 4
  • Clathrin Assembly Protein Complex 2 Medium Chain 2 3
  • Adaptor-Related Protein Complex 2 Subunit Mu 3 4
  • Plasma Membrane Adaptor AP-2 50 KDa Protein 3 4
  • Plasma Membrane Adaptor AP-2 50kDA Protein 2 3
  • Clathrin Adaptor Complex AP2, Mu Subunit 2 3
  • Adaptor Protein Complex AP-2 Subunit Mu 3 4
  • Clathrin Coat-Associated Protein AP50 3 4
  • Clathrin Coat Assembly Protein AP50 3 4
  • Clathrin Coat Adaptor Protein AP50 2 3
  • HA2 50 KDA Subunit 2 3
  • AP-2 Mu 2 Chain 2 3
  • Adaptin-Mu2 3 4
  • CLAPM1 3 4
  • AP-2 Complex Subunit Mu 3
  • HA2 50 KDa Subunit 4
  • AP-2 Mu Chain 4
  • KIAA0109 4
  • AP50 3
  • Mu2 3

External Ids for AP2M1 Gene

Previous HGNC Symbols for AP2M1 Gene

  • CLAPM1

Previous GeneCards Identifiers for AP2M1 Gene

  • GC03M180722
  • GC03P184887
  • GC03P185294
  • GC03P185213
  • GC03P185375
  • GC03P183892
  • GC03P181299

Summaries for AP2M1 Gene

Entrez Gene Summary for AP2M1 Gene

  • This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]

GeneCards Summary for AP2M1 Gene

AP2M1 (Adaptor Related Protein Complex 2 Subunit Mu 1) is a Protein Coding gene. Diseases associated with AP2M1 include Pain Agnosia and Agnosia. Among its related pathways are Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity and EGF/EGFR Signaling Pathway. Gene Ontology (GO) annotations related to this gene include transporter activity and low-density lipoprotein particle receptor binding. An important paralog of this gene is AP1M1.

UniProtKB/Swiss-Prot for AP2M1 Gene

  • Component of the adaptor protein complex 2 (AP-2). Adaptor protein complexes function in protein transport via transport vesicles in different membrane traffic pathways. Adaptor protein complexes are vesicle coat components and appear to be involved in cargo selection and vesicle formation. AP-2 is involved in clathrin-dependent endocytosis in which cargo proteins are incorporated into vesicles surrounded by clathrin (clathrin-coated vesicles, CCVs) which are destined for fusion with the early endosome. The clathrin lattice serves as a mechanical scaffold but is itself unable to bind directly to membrane components. Clathrin-associated adaptor protein (AP) complexes which can bind directly to both the clathrin lattice and to the lipid and protein components of membranes are considered to be the major clathrin adaptors contributing the CCV formation. AP-2 also serves as a cargo receptor to selectively sort the membrane proteins involved in receptor-mediated endocytosis. AP-2 seems to play a role in the recycling of synaptic vesicle membranes from the presynaptic surface. AP-2 recognizes Y-X-X-[FILMV] (Y-X-X-Phi) and [ED]-X-X-X-L-[LI] endocytosis signal motifs within the cytosolic tails of transmembrane cargo molecules. AP-2 may also play a role in maintaining normal post-endocytic trafficking through the ARF6-regulated, non-clathrin pathway. The AP-2 mu subunit binds to transmembrane cargo proteins; it recognizes the Y-X-X-Phi motifs. The surface region interacting with to the Y-X-X-Phi motif is inaccessible in cytosolic AP-2, but becomes accessible through a conformational change following phosphorylation of AP-2 mu subunit at Tyr-156 in membrane-associated AP-2. The membrane-specific phosphorylation event appears to involve assembled clathrin which activates the AP-2 mu kinase AAK1 (By similarity). Plays a role in endocytosis of frizzled family members upon Wnt signaling (By similarity).

Gene Wiki entry for AP2M1 Gene

Additional gene information for AP2M1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AP2M1 Gene

Genomics for AP2M1 Gene

GeneHancer (GH) Regulatory Elements for AP2M1 Gene

Promoters and enhancers for AP2M1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J184171 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 655.2 +0.5 473 8 HDGF ARID4B NEUROD1 SIN3A DMAP1 YY1 POLR2B ZNF766 ZNF143 FOS AP2M1 VWA5B2 ABCF3 EIF2B5 DVL3 ALG3 ECE2 MIR1224 CAMK2N2
GH03J184180 Promoter 0.6 EPDnew 650.4 +5.5 5498 0.1 GABPA AP2M1 EIF2B5 VWA5B2 ECE2 ALG3 MIR1224 CAMK2N2 PSMD2 EIF4G1 ABCF3
GH03J184015 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE 10 -157.7 -157687 3.6 HDGF PKNOX1 SMAD1 ARNT ARID4B SIN3A FEZF1 ZNF2 YY1 POLR2B ABCC5 YEATS2 HTR3D ENSG00000271682 RPS3P3 HTR3C EIF2B5 AP2M1 ALG3 CAMK2N2
GH03J184133 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 10.7 -39.5 -39451 3.1 FEZF1 DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 SP3 ZNF610 GLIS1 EIF2B5 ENSG00000273181 ENSG00000272721 LOC105374249 DVL3 VWA5B2 RPS3P3 POLR2H AP2M1 ABCC5-AS1
GH03J184149 Enhancer 0.4 Ensembl 11.3 -24.7 -24688 0.4 CTCF IKZF1 RAD21 RPS3P3 AP2M1 CAMK2N2 VWA5B2 ECE2 ALG3 MIR1224 PARL RPSAP31 DVL3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around AP2M1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AP2M1 gene promoter:

Genomic Locations for AP2M1 Gene

Genomic Locations for AP2M1 Gene
chr3:184,174,689-184,184,091
(GRCh38/hg38)
Size:
9,403 bases
Orientation:
Plus strand
chr3:183,892,477-183,901,879
(GRCh37/hg19)

Genomic View for AP2M1 Gene

Genes around AP2M1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AP2M1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AP2M1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AP2M1 Gene

Proteins for AP2M1 Gene

  • Protein details for AP2M1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96CW1-AP2M1_HUMAN
    Recommended name:
    AP-2 complex subunit mu
    Protein Accession:
    Q96CW1
    Secondary Accessions:
    • A6NE12
    • D3DNT1
    • P20172
    • P53679

    Protein attributes for AP2M1 Gene

    Size:
    435 amino acids
    Molecular mass:
    49655 Da
    Quaternary structure:
    • Adaptor protein complex 2 (AP-2) is a heterotetramer composed of two large adaptins (alpha-type subunit AP2A1 or AP2A2 and beta-type subunit AP2B1), a medium adaptin (mu-type subunit AP2M1) and a small adaptin (sigma-type subunit AP2S1). Interacts with ATP6V1H and MEGF10. Interacts with EGFR. Interacts with F2R. Interacts with PIP5K1C; tyrosine phosphorylation of PIP5K1C weakens the interaction (By similarity). Interacts with KIAA0319; required for clathrin-mediated endocytosis of KIAA0319. Interacts with DVL2 (via DEP domain) (By similarity). Interacts with KCNQ1; mediates estrogen-induced internalization via clathrin-coated vesicles (PubMed:23529131).
    SequenceCaution:
    • Sequence=BAA09762.2; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for AP2M1 Gene

    Alternative splice isoforms for AP2M1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AP2M1 Gene

Post-translational modifications for AP2M1 Gene

  • Ubiquitination at posLast=420420, Lys410, posLast=380380, posLast=378378, and Lys312
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for AP2M1 Gene

Domains & Families for AP2M1 Gene

Gene Families for AP2M1 Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for AP2M1 Gene

Graphical View of Domain Structure for InterPro Entry

Q96CW1

UniProtKB/Swiss-Prot:

AP2M1_HUMAN :
  • Belongs to the adaptor complexes medium subunit family.
Family:
  • Belongs to the adaptor complexes medium subunit family.
genes like me logo Genes that share domains with AP2M1: view

Function for AP2M1 Gene

Molecular function for AP2M1 Gene

UniProtKB/Swiss-Prot Function:
Component of the adaptor protein complex 2 (AP-2). Adaptor protein complexes function in protein transport via transport vesicles in different membrane traffic pathways. Adaptor protein complexes are vesicle coat components and appear to be involved in cargo selection and vesicle formation. AP-2 is involved in clathrin-dependent endocytosis in which cargo proteins are incorporated into vesicles surrounded by clathrin (clathrin-coated vesicles, CCVs) which are destined for fusion with the early endosome. The clathrin lattice serves as a mechanical scaffold but is itself unable to bind directly to membrane components. Clathrin-associated adaptor protein (AP) complexes which can bind directly to both the clathrin lattice and to the lipid and protein components of membranes are considered to be the major clathrin adaptors contributing the CCV formation. AP-2 also serves as a cargo receptor to selectively sort the membrane proteins involved in receptor-mediated endocytosis. AP-2 seems to play a role in the recycling of synaptic vesicle membranes from the presynaptic surface. AP-2 recognizes Y-X-X-[FILMV] (Y-X-X-Phi) and [ED]-X-X-X-L-[LI] endocytosis signal motifs within the cytosolic tails of transmembrane cargo molecules. AP-2 may also play a role in maintaining normal post-endocytic trafficking through the ARF6-regulated, non-clathrin pathway. The AP-2 mu subunit binds to transmembrane cargo proteins; it recognizes the Y-X-X-Phi motifs. The surface region interacting with to the Y-X-X-Phi motif is inaccessible in cytosolic AP-2, but becomes accessible through a conformational change following phosphorylation of AP-2 mu subunit at Tyr-156 in membrane-associated AP-2. The membrane-specific phosphorylation event appears to involve assembled clathrin which activates the AP-2 mu kinase AAK1 (By similarity). Plays a role in endocytosis of frizzled family members upon Wnt signaling (By similarity).

Gene Ontology (GO) - Molecular Function for AP2M1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005048 signal sequence binding IDA 8918456
GO:0005215 transporter activity TAS 7989329
GO:0005515 protein binding IPI 10910768
GO:0008289 lipid binding IEA --
GO:0035615 contributes_to clathrin adaptor activity TAS 12121421
genes like me logo Genes that share ontologies with AP2M1: view
genes like me logo Genes that share phenotypes with AP2M1: view

Animal Models for AP2M1 Gene

MGI Knock Outs for AP2M1:

Animal Model Products

CRISPR Products

miRNA for AP2M1 Gene

miRTarBase miRNAs that target AP2M1

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AP2M1

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for AP2M1 Gene

Localization for AP2M1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for AP2M1 Gene

Cell membrane. Membrane, coated pit; Peripheral membrane protein; Cytoplasmic side. Note=AP-2 appears to be excluded from internalizing CCVs and to disengage from sites of endocytosis seconds before internalization of the nascent CCV. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AP2M1 gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytosol 5
lysosome 5
endosome 5
nucleus 2
golgi apparatus 2
cytoskeleton 1
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Plasma membrane (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for AP2M1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005765 lysosomal membrane TAS --
GO:0005829 cytosol TAS --
GO:0005886 plasma membrane IDA,TAS --
GO:0005905 clathrin-coated pit IEA --
genes like me logo Genes that share ontologies with AP2M1: view

Pathways & Interactions for AP2M1 Gene

genes like me logo Genes that share pathways with AP2M1: view

SIGNOR curated interactions for AP2M1 Gene

Inactivates:
Is activated by:

Gene Ontology (GO) - Biological Process for AP2M1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006886 intracellular protein transport IEA --
GO:0006897 endocytosis IEA --
GO:0007018 microtubule-based movement TAS --
GO:0015031 protein transport IEA --
GO:0016050 vesicle organization IMP 25898166
genes like me logo Genes that share ontologies with AP2M1: view

Drugs & Compounds for AP2M1 Gene

(1) Drugs for AP2M1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with AP2M1: view

Transcripts for AP2M1 Gene

mRNA/cDNA for AP2M1 Gene

Unigene Clusters for AP2M1 Gene

Adaptor-related protein complex 2, mu 1 subunit:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for AP2M1

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AP2M1 Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b · 2c · 2d ^ 3 ^ 4a · 4b · 4c ^ 5a · 5b · 5c · 5d · 5e ^ 6 ^ 7a · 7b ^ 8a · 8b · 8c ^ 9a ·
SP1: - - - - - - - -
SP2: - - - - - - - -
SP3: - - - - - - - -
SP4: - - - - - - - - - - - - - -
SP5: - - - - -
SP6: - - - -
SP7: - - -
SP8:
SP9: -
SP10: - -
SP11: - - -
SP12:
SP13:

ExUns: 9b · 9c ^ 10 ^ 11a · 11b ^ 12a · 12b ^ 13a · 13b ^ 14
SP1: - - - -
SP2:
SP3:
SP4: - -
SP5:
SP6:
SP7:
SP8: - -
SP9:
SP10:
SP11:
SP12:
SP13: -

Relevant External Links for AP2M1 Gene

GeneLoc Exon Structure for
AP2M1
ECgene alternative splicing isoforms for
AP2M1

Expression for AP2M1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AP2M1 Gene

Protein differential expression in normal tissues from HIPED for AP2M1 Gene

This gene is overexpressed in Frontal cortex (8.3) and Brain (7.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for AP2M1 Gene



Protein tissue co-expression partners for AP2M1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of AP2M1 Gene:

AP2M1

SOURCE GeneReport for Unigene cluster for AP2M1 Gene:

Hs.518460

Evidence on tissue expression from TISSUES for AP2M1 Gene

  • Nervous system(5)
  • Kidney(4.9)
  • Skin(4.9)
  • Heart(4.8)
  • Liver(4.8)
  • Lung(4.6)
  • Bone marrow(4.4)
  • Intestine(4.4)
  • Eye(4.3)
  • Pancreas(3.6)
  • Blood(3.5)
  • Muscle(2.9)
  • Spleen(2.7)
  • Stomach(2.5)
  • Thyroid gland(2.4)
  • Adrenal gland(2.2)
  • Bone(2.2)
  • Gall bladder(2)
genes like me logo Genes that share expression patterns with AP2M1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for AP2M1 Gene

Orthologs for AP2M1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for AP2M1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia AP2M1 34 33
  • 99.77 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia AP2M1 34
  • 97 (a)
OneToOne
dog
(Canis familiaris)
Mammalia AP2M1 34 33
  • 94.56 (n)
OneToOne
cow
(Bos Taurus)
Mammalia AP2M1 34 33
  • 93.56 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Ap2m1 16 34 33
  • 92.64 (n)
rat
(Rattus norvegicus)
Mammalia Ap2m1 33
  • 92.41 (n)
chicken
(Gallus gallus)
Aves AP2M1 34 33
  • 84.6 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia AP2M1 34
  • 99 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ap2m1 33
  • 83.83 (n)
zebrafish
(Danio rerio)
Actinopterygii ap2m1a 34
  • 98 (a)
OneToMany
ap2m1b 34 33
  • 84.37 (n)
OneToMany
zgc56643 33
fruit fly
(Drosophila melanogaster)
Insecta AP-50 34 35 33
  • 76.37 (n)
OneToOne
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP007131 33
  • 75.67 (n)
worm
(Caenorhabditis elegans)
Secernentea dpy-23 34 35 33
  • 71.11 (n)
OneToOne
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes APM1 34
  • 34 (a)
OneToMany
APM4 36
thale cress
(Arabidopsis thaliana)
eudicotyledons AT5G46630 33
  • 54.85 (n)
soybean
(Glycine max)
eudicotyledons Gma.8717 33
rice
(Oryza sativa)
Liliopsida Os02g0690700 33
  • 53.44 (n)
Os.8929 33
corn
(Zea mays)
Liliopsida Zm.17830 33
sea squirt
(Ciona savignyi)
Ascidiacea CSA.947 34
  • 86 (a)
OneToOne
Cin.10579 33
bread mold
(Neurospora crassa)
Ascomycetes NCU09673 33
  • 59.42 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes apm4 33
  • 49.46 (n)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.10579 33
Species where no ortholog for AP2M1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for AP2M1 Gene

ENSEMBL:
Gene Tree for AP2M1 (if available)
TreeFam:
Gene Tree for AP2M1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for AP2M1: view image

Paralogs for AP2M1 Gene

Paralogs for AP2M1 Gene

(5) SIMAP similar genes for AP2M1 Gene using alignment to 8 proteins:

  • AP2M1_HUMAN
  • C9JGT8_HUMAN
  • C9JJ47_HUMAN
  • C9JJD3_HUMAN
  • C9JPV8_HUMAN
  • C9JTK4_HUMAN
  • E9PFW3_HUMAN
  • H7C4C3_HUMAN
genes like me logo Genes that share paralogs with AP2M1: view

Variants for AP2M1 Gene

Sequence variations from dbSNP and Humsavar for AP2M1 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1000083186 -- 184,182,521(+) G/C intron_variant
rs1000299976 -- 184,173,605(+) ATTATTATTATTTTATCATTATTATTATTT/ATTATTATTATTT upstream_transcript_variant
rs1000680974 -- 184,183,954(+) C/T 3_prime_UTR_variant
rs1000732874 -- 184,183,686(+) C/A/G/T 3_prime_UTR_variant
rs1000804653 -- 184,176,813(+) G/A intron_variant

Structural Variations from Database of Genomic Variants (DGV) for AP2M1 Gene

Variant ID Type Subtype PubMed ID
nsv829812 CNV loss 17160897

Variation tolerance for AP2M1 Gene

Residual Variation Intolerance Score: 30.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.01; 20.68% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AP2M1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
AP2M1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AP2M1 Gene

Disorders for AP2M1 Gene

MalaCards: The human disease database

(3) MalaCards diseases for AP2M1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
pain agnosia
  • analgesia
agnosia
  • dyspraxia
retinitis pigmentosa 42
  • rp42
- elite association - COSMIC cancer census association via MalaCards
Search AP2M1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for AP2M1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with AP2M1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for AP2M1 Gene

Publications for AP2M1 Gene

  1. Chromosome localization of human genes for clathrin adaptor polypeptides AP2 beta and AP50 and the clathrin-binding protein, VCP. (PMID: 8595912) Druck T … Keen JH (Genomics 1995) 2 3 22 58
  2. Oestrogen promotes KCNQ1 potassium channel endocytosis and postendocytic trafficking in colonic epithelium. (PMID: 23529131) Rapetti-Mauss R … Harvey BJ (The Journal of physiology 2013) 3 4 58
  3. The dyslexia-associated protein KIAA0319 interacts with adaptor protein 2 and follows the classical clathrin-mediated endocytosis pathway. (PMID: 19419997) Levecque C … Monaco AP (American journal of physiology. Cell physiology 2009) 3 4 58
  4. Association of genetic variants with chronic kidney disease in individuals with different lipid profiles. (PMID: 19578796) Yoshida T … Yamada Y (International journal of molecular medicine 2009) 3 44 58
  5. MEGF10 is a mammalian ortholog of CED-1 that interacts with clathrin assembly protein complex 2 medium chain and induces large vacuole formation. (PMID: 17643423) Suzuki E … Nakayama M (Experimental cell research 2007) 4 22 58

Products for AP2M1 Gene

Sources for AP2M1 Gene

Content
Loading form....